Incidental Mutation 'R7845:Rfx6'
ID606567
Institutional Source Beutler Lab
Gene Symbol Rfx6
Ensembl Gene ENSMUSG00000019900
Gene Nameregulatory factor X, 6
SynonymsRfxdc1, 4930572O07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7845 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location51677756-51730432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51678026 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 73 (S73T)
Ref Sequence ENSEMBL: ENSMUSP00000151430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122922] [ENSMUST00000219364]
Predicted Effect probably benign
Transcript: ENSMUST00000122922
AA Change: S73T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000116057
Gene: ENSMUSG00000019900
AA Change: S73T

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 120 198 1.9e-33 PFAM
Blast:HisKA 355 417 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000219364
AA Change: S73T

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes fail to feed normally, show small bowel obstruction and die within 2 days of birth. Mutants fail to generate any of the normal islet cell types except for pancreatic-polypeptide-producing cells. Some display a reduced pancreas size; however, primary cilia formation in islets is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mast1 C A 8: 84,925,325 E343* probably null Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Ranbp2 G A 10: 58,447,022 V15M probably damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Rfx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Rfx6 APN 10 51681886 missense probably damaging 1.00
IGL00816:Rfx6 APN 10 51678405 missense probably benign 0.16
IGL01639:Rfx6 APN 10 51715906 nonsense probably null
IGL01721:Rfx6 APN 10 51723077 missense probably damaging 1.00
IGL01861:Rfx6 APN 10 51721579 missense probably damaging 1.00
IGL02103:Rfx6 APN 10 51726856 missense possibly damaging 0.93
IGL02113:Rfx6 APN 10 51678012 missense probably benign
IGL02479:Rfx6 APN 10 51678328 missense probably benign 0.07
IGL02592:Rfx6 APN 10 51716023 missense probably damaging 1.00
IGL02635:Rfx6 APN 10 51716026 missense possibly damaging 0.80
IGL02891:Rfx6 APN 10 51723846 missense possibly damaging 0.64
IGL03153:Rfx6 APN 10 51723121 nonsense probably null
IGL03263:Rfx6 APN 10 51725807 missense probably benign 0.00
IGL03373:Rfx6 APN 10 51720000 missense probably damaging 0.99
bulky UTSW 10 51678333 missense probably benign 0.00
R0060:Rfx6 UTSW 10 51677840 missense probably benign 0.00
R0433:Rfx6 UTSW 10 51720028 missense probably damaging 1.00
R1329:Rfx6 UTSW 10 51693737 missense probably damaging 1.00
R1709:Rfx6 UTSW 10 51678402 missense possibly damaging 0.64
R1820:Rfx6 UTSW 10 51723125 critical splice donor site probably null
R2017:Rfx6 UTSW 10 51721604 missense possibly damaging 0.50
R2020:Rfx6 UTSW 10 51720057 critical splice donor site probably null
R2044:Rfx6 UTSW 10 51718126 missense probably benign 0.16
R2495:Rfx6 UTSW 10 51726675 splice site probably benign
R2655:Rfx6 UTSW 10 51693777 splice site probably benign
R2912:Rfx6 UTSW 10 51718130 missense probably damaging 1.00
R3159:Rfx6 UTSW 10 51726720 missense probably damaging 1.00
R4036:Rfx6 UTSW 10 51726746 missense probably damaging 1.00
R4536:Rfx6 UTSW 10 51723784 missense probably benign 0.16
R4791:Rfx6 UTSW 10 51719944 splice site probably null
R4945:Rfx6 UTSW 10 51726851 nonsense probably null
R5223:Rfx6 UTSW 10 51677996 nonsense probably null
R5233:Rfx6 UTSW 10 51712091 nonsense probably null
R5448:Rfx6 UTSW 10 51683637 missense probably damaging 1.00
R5600:Rfx6 UTSW 10 51723061 missense probably damaging 1.00
R5768:Rfx6 UTSW 10 51726880 missense probably damaging 0.99
R5858:Rfx6 UTSW 10 51725868 missense probably benign 0.00
R5949:Rfx6 UTSW 10 51678333 missense probably benign 0.00
R6001:Rfx6 UTSW 10 51718211 splice site probably null
R6003:Rfx6 UTSW 10 51708587 missense probably damaging 1.00
R6118:Rfx6 UTSW 10 51711866 missense possibly damaging 0.91
R6629:Rfx6 UTSW 10 51725490 missense probably benign 0.02
R6876:Rfx6 UTSW 10 51719991 missense probably damaging 1.00
R6894:Rfx6 UTSW 10 51716039 missense probably damaging 1.00
R6912:Rfx6 UTSW 10 51723853 missense probably benign 0.00
R7130:Rfx6 UTSW 10 51678380 nonsense probably null
R7574:Rfx6 UTSW 10 51681818 missense probably benign 0.17
R8188:Rfx6 UTSW 10 51718196 missense probably benign 0.05
R8338:Rfx6 UTSW 10 51718094 missense probably damaging 0.96
V8831:Rfx6 UTSW 10 51718208 critical splice donor site probably null
X0023:Rfx6 UTSW 10 51678411 missense probably damaging 1.00
Z1176:Rfx6 UTSW 10 51718093 missense probably benign 0.05
Z1176:Rfx6 UTSW 10 51725831 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACACAGAGCTCCTTCAAGC -3'
(R):5'- CTTGCTTTGCACCCAAGGAG -3'

Sequencing Primer
(F):5'- AAGCTTTCGTGCAGGAGC -3'
(R):5'- TGCACCCAAGGAGGAGCAAG -3'
Posted On2019-12-20