Incidental Mutation 'R7845:Mast1'
ID606561
Institutional Source Beutler Lab
Gene Symbol Mast1
Ensembl Gene ENSMUSG00000053693
Gene Namemicrotubule associated serine/threonine kinase 1
SynonymsSAST170, SAST, 9430008B02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7845 (G1)
Quality Score191.009
Status Validated
Chromosome8
Chromosomal Location84911903-84937359 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 84925325 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 343 (E343*)
Ref Sequence ENSEMBL: ENSMUSP00000105363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109741] [ENSMUST00000119820]
Predicted Effect probably null
Transcript: ENSMUST00000109741
AA Change: E343*
SMART Domains Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: E343*

DomainStartEndE-ValueType
Pfam:DUF1908 61 337 1.4e-136 PFAM
S_TKc 376 649 4.07e-97 SMART
S_TK_X 650 710 6.23e-2 SMART
low complexity region 820 836 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 933 961 N/A INTRINSIC
PDZ 977 1057 3.49e-14 SMART
low complexity region 1104 1132 N/A INTRINSIC
low complexity region 1149 1174 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1243 1252 N/A INTRINSIC
low complexity region 1479 1492 N/A INTRINSIC
low complexity region 1519 1535 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119820
AA Change: E343*
SMART Domains Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693
AA Change: E343*

DomainStartEndE-ValueType
Pfam:DUF1908 61 338 5.1e-148 PFAM
S_TKc 376 644 2.79e-86 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Ranbp2 G A 10: 58,447,022 V15M probably damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Mast1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Mast1 APN 8 84912815 missense possibly damaging 0.87
IGL01862:Mast1 APN 8 84913246 splice site probably null
IGL01918:Mast1 APN 8 84921209 missense probably damaging 1.00
IGL02212:Mast1 APN 8 84921397 missense probably damaging 1.00
IGL02221:Mast1 APN 8 84918755 missense possibly damaging 0.92
IGL02370:Mast1 APN 8 84912254 missense probably benign
IGL02470:Mast1 APN 8 84921212 missense probably damaging 1.00
IGL02596:Mast1 APN 8 84917771 missense probably benign
IGL02716:Mast1 APN 8 84935723 missense probably damaging 1.00
IGL02987:Mast1 APN 8 84925719 missense possibly damaging 0.75
IGL03287:Mast1 APN 8 84913353 missense probably benign 0.01
R0255:Mast1 UTSW 8 84912021 missense probably benign
R0388:Mast1 UTSW 8 84915537 missense probably benign 0.13
R0480:Mast1 UTSW 8 84913089 missense probably damaging 0.99
R0727:Mast1 UTSW 8 84921415 missense probably damaging 1.00
R1175:Mast1 UTSW 8 84925327 missense probably benign 0.29
R1297:Mast1 UTSW 8 84912716 missense probably benign 0.05
R1328:Mast1 UTSW 8 84917988 intron probably benign
R1454:Mast1 UTSW 8 84920635 missense probably damaging 1.00
R1532:Mast1 UTSW 8 84928609 nonsense probably null
R1752:Mast1 UTSW 8 84925336 missense probably benign
R1777:Mast1 UTSW 8 84912068 missense probably benign
R1905:Mast1 UTSW 8 84916266 missense probably damaging 1.00
R1906:Mast1 UTSW 8 84916266 missense probably damaging 1.00
R1907:Mast1 UTSW 8 84916266 missense probably damaging 1.00
R2056:Mast1 UTSW 8 84920366 missense possibly damaging 0.95
R2071:Mast1 UTSW 8 84921194 missense probably damaging 1.00
R2145:Mast1 UTSW 8 84921478 missense probably damaging 1.00
R2318:Mast1 UTSW 8 84921125 missense probably damaging 1.00
R2842:Mast1 UTSW 8 84923908 missense probably damaging 1.00
R3870:Mast1 UTSW 8 84918731 missense probably damaging 1.00
R3895:Mast1 UTSW 8 84935723 missense probably damaging 1.00
R3973:Mast1 UTSW 8 84918764 missense probably damaging 1.00
R4405:Mast1 UTSW 8 84920891 missense probably damaging 1.00
R4533:Mast1 UTSW 8 84921361 missense probably damaging 1.00
R4725:Mast1 UTSW 8 84929006 missense possibly damaging 0.93
R4770:Mast1 UTSW 8 84929246 missense probably benign 0.02
R4776:Mast1 UTSW 8 84937193 critical splice donor site probably null
R4835:Mast1 UTSW 8 84923779 missense probably damaging 1.00
R4871:Mast1 UTSW 8 84920658 missense probably damaging 1.00
R4953:Mast1 UTSW 8 84918728 missense probably damaging 0.99
R4960:Mast1 UTSW 8 84917871 missense probably benign
R4978:Mast1 UTSW 8 84935787 missense probably damaging 0.98
R5164:Mast1 UTSW 8 84913518 unclassified probably benign
R5235:Mast1 UTSW 8 84913439 missense probably damaging 1.00
R5297:Mast1 UTSW 8 84913318 critical splice donor site probably null
R5463:Mast1 UTSW 8 84925507 missense probably damaging 1.00
R5546:Mast1 UTSW 8 84916260 missense probably damaging 1.00
R5651:Mast1 UTSW 8 84928968 nonsense probably null
R6124:Mast1 UTSW 8 84925307 missense probably benign 0.01
R6213:Mast1 UTSW 8 84915569 missense probably damaging 1.00
R6717:Mast1 UTSW 8 84917754 missense probably benign
R7000:Mast1 UTSW 8 84928969 missense probably damaging 1.00
R7011:Mast1 UTSW 8 84911945 nonsense probably null
R7164:Mast1 UTSW 8 84935304 missense possibly damaging 0.81
R7695:Mast1 UTSW 8 84920928 missense probably damaging 1.00
R7882:Mast1 UTSW 8 84913318 critical splice donor site probably null
R8167:Mast1 UTSW 8 84921358 missense probably damaging 1.00
R8197:Mast1 UTSW 8 84912821 missense possibly damaging 0.90
X0066:Mast1 UTSW 8 84920878 missense probably damaging 1.00
Z1176:Mast1 UTSW 8 84912459 missense probably damaging 0.97
Z1176:Mast1 UTSW 8 84918681 missense probably damaging 1.00
Z1177:Mast1 UTSW 8 84920446 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AATAAAGCTCTGGGTCCCACTC -3'
(R):5'- AGAGTTCTACCACCTTCTGGAG -3'

Sequencing Primer
(F):5'- TGGGTCCCACTCTATCAACAC -3'
(R):5'- TTCTGGAGGCAGCCGAG -3'
Posted On2019-12-20