Incidental Mutation 'R7892:Zc3hav1'
ID609381
Institutional Source Beutler Lab
Gene Symbol Zc3hav1
Ensembl Gene ENSMUSG00000029826
Gene Namezinc finger CCCH type, antiviral 1
Synonyms9130009D18Rik, 2900058M19Rik, ZAP, 1200014N16Rik, 9830115L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7892 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location38305286-38354603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38329221 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 632 (I632T)
Ref Sequence ENSEMBL: ENSMUSP00000144312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031850] [ENSMUST00000114898] [ENSMUST00000114900] [ENSMUST00000143702]
Predicted Effect probably benign
Transcript: ENSMUST00000031850
AA Change: I632T

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031850
Gene: ENSMUSG00000029826
AA Change: I632T

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 9.6e-6 PROSPERO
internal_repeat_1 166 208 9.6e-6 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114898
AA Change: I516T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000110548
Gene: ENSMUSG00000029826
AA Change: I516T

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 8.18e-6 PROSPERO
internal_repeat_1 166 208 8.18e-6 PROSPERO
low complexity region 338 350 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114900
AA Change: I632T

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110550
Gene: ENSMUSG00000029826
AA Change: I632T

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.94e-5 PROSPERO
internal_repeat_1 166 208 1.94e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 2.8e-15 PFAM
Pfam:PARP 817 986 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143702
AA Change: I632T

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144312
Gene: ENSMUSG00000029826
AA Change: I632T

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.8e-5 PROSPERO
internal_repeat_1 166 208 1.8e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 1e-15 PFAM
Pfam:PARP 817 922 1.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CCCH-type zinc finger protein that is thought to prevent infection by retroviruses. Studies of the rat homolog indicate that the protein may primarily function to inhibit viral gene expression and induce an innate immunity to viral infection. Alternative splicing occurs at this locus and two variants, each encoding distinct isoforms, are described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced murine leukemia virus replication efficiency in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,618,485 E134G Het
Acsm4 G A 7: 119,694,666 V87M possibly damaging Het
Adamts3 T C 5: 89,861,429 N125S probably benign Het
AI314180 T C 4: 58,828,593 I947V probably benign Het
Arhgef4 A G 1: 34,721,804 E47G unknown Het
BC067074 C T 13: 113,319,606 R729C Het
C1ra A G 6: 124,519,415 M367V probably benign Het
Ces2b T C 8: 104,832,753 W84R probably damaging Het
Clca3a1 T C 3: 144,730,818 T835A probably benign Het
Cmya5 T C 13: 93,096,357 E741G probably damaging Het
D330020A13Rik T C 6: 120,294,858 L165P unknown Het
Dtnbp1 A T 13: 44,922,289 L326* probably null Het
Fat4 A T 3: 38,949,439 probably null Het
Fuom T A 7: 140,099,579 I143F unknown Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm14444 A T 2: 175,016,731 M33L probably damaging Het
Gm21818 G T 13: 120,173,159 probably benign Het
Hmcn1 T C 1: 150,664,892 T2889A probably benign Het
Kif5b G A 18: 6,212,517 T769M probably benign Het
Kif9 G A 9: 110,514,614 R567H not run Het
Kmt2c A T 5: 25,299,816 M3498K probably benign Het
Lrrc29 A T 8: 105,315,533 I221N possibly damaging Het
Ly6e T A 15: 74,957,851 L15* probably null Het
Malt1 G A 18: 65,464,116 probably null Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Oacyl T C 18: 65,737,847 L373P probably benign Het
Olfr1444 C T 19: 12,862,479 R235* probably null Het
Olfr1471 T A 19: 13,445,298 C95* probably null Het
Olfr32 T C 2: 90,138,492 I216V probably benign Het
Olfr959 A C 9: 39,572,549 S237A possibly damaging Het
Pcdh20 A T 14: 88,467,431 L811* probably null Het
Pgrmc2 A T 3: 41,082,980 D5E probably damaging Het
Pign A C 1: 105,657,676 F49L probably benign Het
Pip5k1b T C 19: 24,360,093 D277G probably benign Het
Ppm1m A G 9: 106,198,696 V11A probably benign Het
Prl7a1 A T 13: 27,633,678 V201E not run Het
Samhd1 A G 2: 157,116,495 S269P probably damaging Het
Sik2 A G 9: 51,008,832 V15A probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sntg1 T C 1: 8,782,800 D42G probably damaging Het
Speg A T 1: 75,427,166 N2664Y probably damaging Het
Treh A G 9: 44,684,718 Y435C probably damaging Het
Trim59 A G 3: 69,037,807 S67P probably benign Het
Trim68 A T 7: 102,678,797 C309S unknown Het
Tubb4a G T 17: 57,080,880 S382* probably null Het
Vmn2r15 A T 5: 109,286,351 I829N probably damaging Het
Vmn2r68 T C 7: 85,234,514 T128A probably benign Het
Vmn2r70 T A 7: 85,559,380 I630L possibly damaging Het
Zfp558 A G 9: 18,468,697 S13P possibly damaging Het
Other mutations in Zc3hav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Zc3hav1 APN 6 38319833 splice site probably null
IGL02225:Zc3hav1 APN 6 38340341 missense probably damaging 1.00
IGL02266:Zc3hav1 APN 6 38332168 missense probably benign 0.01
IGL02458:Zc3hav1 APN 6 38340329 missense probably damaging 1.00
IGL02626:Zc3hav1 APN 6 38332991 missense probably damaging 0.96
IGL02725:Zc3hav1 APN 6 38332192 missense probably damaging 0.98
IGL02958:Zc3hav1 APN 6 38332984 missense probably damaging 1.00
IGL03104:Zc3hav1 APN 6 38340343 missense probably damaging 1.00
IGL03137:Zc3hav1 APN 6 38332394 missense probably benign
IGL03238:Zc3hav1 APN 6 38332750 missense probably damaging 0.99
IGL03380:Zc3hav1 APN 6 38336558 missense probably damaging 1.00
IGL03055:Zc3hav1 UTSW 6 38316316 splice site probably null
P0038:Zc3hav1 UTSW 6 38332534 missense probably damaging 0.98
R0006:Zc3hav1 UTSW 6 38319702 critical splice donor site probably null
R0207:Zc3hav1 UTSW 6 38311174 missense probably benign 0.00
R0255:Zc3hav1 UTSW 6 38336550 missense probably damaging 1.00
R0452:Zc3hav1 UTSW 6 38307437 missense probably benign 0.01
R0505:Zc3hav1 UTSW 6 38332664 missense probably damaging 1.00
R0865:Zc3hav1 UTSW 6 38353902 splice site probably benign
R1281:Zc3hav1 UTSW 6 38353937 missense probably damaging 1.00
R1531:Zc3hav1 UTSW 6 38307235 missense possibly damaging 0.91
R1873:Zc3hav1 UTSW 6 38332757 missense possibly damaging 0.50
R1991:Zc3hav1 UTSW 6 38336517 missense probably damaging 1.00
R2149:Zc3hav1 UTSW 6 38336537 missense probably damaging 1.00
R2184:Zc3hav1 UTSW 6 38307408 missense probably damaging 0.99
R2365:Zc3hav1 UTSW 6 38340233 missense probably damaging 1.00
R2924:Zc3hav1 UTSW 6 38354110 missense probably damaging 0.97
R3237:Zc3hav1 UTSW 6 38319715 missense probably damaging 1.00
R3710:Zc3hav1 UTSW 6 38332162 missense probably benign 0.35
R5683:Zc3hav1 UTSW 6 38307237 missense probably damaging 1.00
R5684:Zc3hav1 UTSW 6 38311279 missense probably benign 0.01
R5905:Zc3hav1 UTSW 6 38307340 missense probably benign 0.03
R5959:Zc3hav1 UTSW 6 38307444 missense probably benign 0.01
R6028:Zc3hav1 UTSW 6 38307340 missense probably benign 0.03
R6261:Zc3hav1 UTSW 6 38333000 missense probably benign 0.24
R6465:Zc3hav1 UTSW 6 38331849 missense possibly damaging 0.85
R6682:Zc3hav1 UTSW 6 38325195 missense probably benign 0.02
R6831:Zc3hav1 UTSW 6 38332168 missense probably benign 0.01
R7082:Zc3hav1 UTSW 6 38332393 nonsense probably null
R7196:Zc3hav1 UTSW 6 38329272 missense probably benign
R7248:Zc3hav1 UTSW 6 38353976 missense probably benign 0.04
R7319:Zc3hav1 UTSW 6 38332274 missense probably benign
R7506:Zc3hav1 UTSW 6 38332940 nonsense probably null
R7593:Zc3hav1 UTSW 6 38329186 missense probably benign 0.01
R7788:Zc3hav1 UTSW 6 38332756 missense probably benign 0.02
R7885:Zc3hav1 UTSW 6 38336663 missense possibly damaging 0.82
R8109:Zc3hav1 UTSW 6 38329179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCGAGTGACTAAATCTTCCCAG -3'
(R):5'- GACACTATGCAAGCAGAGGC -3'

Sequencing Primer
(F):5'- GAGTGACTAAATCTTCCCAGAATCTC -3'
(R):5'- CTATGCAAGCAGAGGCCAAAATGAC -3'
Posted On2019-12-20