Incidental Mutation 'R7895:Xpo4'
ID609632
Institutional Source Beutler Lab
Gene Symbol Xpo4
Ensembl Gene ENSMUSG00000021952
Gene Nameexportin 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.730) question?
Stock #R7895 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location57577521-57665430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57602591 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 572 (H572L)
Ref Sequence ENSEMBL: ENSMUSP00000133280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089482] [ENSMUST00000174152] [ENSMUST00000174545]
Predicted Effect probably benign
Transcript: ENSMUST00000089482
AA Change: H572L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000086909
Gene: ENSMUSG00000021952
AA Change: H572L

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 954 1144 6.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174152
Predicted Effect probably benign
Transcript: ENSMUST00000174545
AA Change: H572L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133280
Gene: ENSMUSG00000021952
AA Change: H572L

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 952 1143 5.2e-9 PFAM
Meta Mutation Damage Score 0.0862 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]).[supplied by OMIM, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,059,510 S143T probably benign Het
9030624G23Rik A T 12: 24,044,723 M149K unknown Het
Agpat3 T A 10: 78,283,200 I187F probably benign Het
Ahcyl1 C T 3: 107,669,151 A332T probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Ap5z1 T A 5: 142,470,558 probably null Het
Apob A T 12: 8,011,933 I3472F probably benign Het
Arhgef33 C T 17: 80,373,485 P685S probably benign Het
Arhgef4 T C 1: 34,806,397 I130T probably damaging Het
Arnt2 A T 7: 84,305,198 F263I probably benign Het
Bbof1 A G 12: 84,419,989 R177G probably damaging Het
Bbs2 C A 8: 94,081,136 G372W probably damaging Het
Blmh T A 11: 76,945,895 probably null Het
Ccdc30 A T 4: 119,352,713 probably null Het
Cdca7l G T 12: 117,873,732 L219F probably damaging Het
Cenpu C A 8: 46,562,464 A138E probably benign Het
Cfap65 T A 1: 74,933,162 T13S probably benign Het
Clasp2 A G 9: 113,903,948 M951V probably benign Het
Clca4a A G 3: 144,968,405 S190P probably benign Het
Clcn4 A G 7: 7,295,168 V74A probably benign Het
Cntln C T 4: 85,063,324 T913M possibly damaging Het
Cntnap4 T A 8: 112,752,197 V185E probably damaging Het
Col26a1 C T 5: 136,748,177 probably null Het
Ctcf A T 8: 105,664,058 Q99L possibly damaging Het
Dgke T C 11: 89,040,856 Q524R probably damaging Het
Dhrs7 A T 12: 72,652,460 probably null Het
Dnah7b T C 1: 46,249,950 Y2969H probably damaging Het
Dync1h1 T G 12: 110,616,457 I358S probably damaging Het
Efcab3 A C 11: 105,117,324 D410A probably benign Het
Emilin2 T C 17: 71,273,913 D606G probably benign Het
Ermard C T 17: 15,063,613 T622I possibly damaging Het
Exo1 A G 1: 175,900,996 D542G probably benign Het
Fgd5 A T 6: 91,987,281 D165V probably benign Het
Gdap1 T C 1: 17,161,144 W238R probably damaging Het
Gm11096 T G 17: 81,441,899 I7M unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm436 A T 4: 144,670,343 I273K possibly damaging Het
Gmppb A T 9: 108,050,571 M175L probably benign Het
Gorasp2 G A 2: 70,684,098 S273N probably benign Het
Gtf3c1 T C 7: 125,672,822 M642V possibly damaging Het
Hmx2 T A 7: 131,555,871 L238Q probably damaging Het
Kif13b A G 14: 64,736,149 D316G probably damaging Het
Kmt2c A G 5: 25,373,176 S701P possibly damaging Het
Lama4 T A 10: 39,088,329 N1332K probably damaging Het
Lrp2 T C 2: 69,458,479 D3681G probably damaging Het
Maml3 G T 3: 51,697,722 P722Q probably damaging Het
Mier2 C A 10: 79,541,885 probably benign Het
Ms4a15 A T 19: 10,979,330 probably null Het
Msh5 T C 17: 35,044,379 M158V probably benign Het
Nova2 A T 7: 18,942,345 K136I Het
Npm1 A T 11: 33,156,001 probably null Het
Nr4a3 T A 4: 48,051,390 M48K probably benign Het
Nrap T G 19: 56,354,152 T806P probably benign Het
Ntf3 G A 6: 126,102,240 T101M probably benign Het
Olfr169 G A 16: 19,566,722 R54* probably null Het
Paxbp1 T A 16: 91,025,278 D648V probably damaging Het
Pcdhb18 T A 18: 37,490,467 D283E probably benign Het
Phrf1 C A 7: 141,259,375 Q828K unknown Het
Pigq A T 17: 25,937,325 I43N probably benign Het
Pou6f2 G T 13: 18,125,448 T542K Het
Ppfibp2 T A 7: 107,721,317 probably null Het
Rab1b A T 19: 5,100,496 M163K probably benign Het
Ralgapa1 A G 12: 55,747,149 M567T probably benign Het
Reck T C 4: 43,890,970 V36A probably benign Het
Resp18 C T 1: 75,278,202 D36N probably null Het
Rint1 A C 5: 23,800,722 H134P probably damaging Het
Rps19 A T 7: 24,888,339 K77M possibly damaging Het
Sec24b A T 3: 129,995,949 S808T probably benign Het
Sema4c A C 1: 36,553,118 V216G probably damaging Het
Sept10 T A 10: 59,181,049 T218S probably benign Het
Sept3 A T 15: 82,285,819 H182L probably benign Het
Sipa1 A G 19: 5,652,662 S836P probably benign Het
Slc9a5 A G 8: 105,363,366 K652R probably damaging Het
Slco5a1 T A 1: 12,989,703 I265F possibly damaging Het
Snapc5 T A 9: 64,179,332 M1K probably null Het
Snx5 T A 2: 144,253,820 D307V possibly damaging Het
Srebf2 A T 15: 82,177,240 M381L probably benign Het
Ssh2 G C 11: 77,454,626 E1146Q probably benign Het
Suco A T 1: 161,845,368 probably null Het
Tanc2 T A 11: 105,921,825 L1365Q probably damaging Het
Tas1r3 A G 4: 155,862,548 L200P probably damaging Het
Thbs2 T G 17: 14,676,221 D802A probably damaging Het
Trav3-1 G A 14: 52,581,093 V75M probably benign Het
Trim9 G A 12: 70,255,187 P559L probably benign Het
Trpc6 G A 9: 8,655,218 G683D probably damaging Het
Unc5b C A 10: 60,779,730 V164L possibly damaging Het
Usf3 A T 16: 44,216,202 R348S possibly damaging Het
Vmn1r236 T C 17: 21,287,466 V282A possibly damaging Het
Vmn2r1 A G 3: 64,089,709 E262G possibly damaging Het
Xirp2 A G 2: 67,509,497 E694G probably damaging Het
Zfhx4 A G 3: 5,242,199 T162A probably benign Het
Zfp110 T A 7: 12,837,093 H59Q possibly damaging Het
Other mutations in Xpo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Xpo4 APN 14 57604398 missense probably benign
IGL02537:Xpo4 APN 14 57593833 missense probably benign
IGL02554:Xpo4 APN 14 57590088 missense probably benign 0.00
IGL02826:Xpo4 APN 14 57629420 missense possibly damaging 0.50
IGL03071:Xpo4 APN 14 57618228 missense possibly damaging 0.66
PIT4131001:Xpo4 UTSW 14 57584611 missense probably null 0.98
R0245:Xpo4 UTSW 14 57630240 missense probably damaging 1.00
R0546:Xpo4 UTSW 14 57613274 missense probably benign 0.07
R0606:Xpo4 UTSW 14 57638208 unclassified probably benign
R0761:Xpo4 UTSW 14 57613383 missense probably damaging 0.99
R1775:Xpo4 UTSW 14 57603672 missense probably benign
R1853:Xpo4 UTSW 14 57585907 missense possibly damaging 0.72
R1923:Xpo4 UTSW 14 57590871 missense probably damaging 0.98
R2007:Xpo4 UTSW 14 57586644 missense probably null 0.19
R2035:Xpo4 UTSW 14 57585926 missense possibly damaging 0.57
R2174:Xpo4 UTSW 14 57590090 missense probably damaging 1.00
R2421:Xpo4 UTSW 14 57629503 missense probably benign 0.00
R2937:Xpo4 UTSW 14 57604440 missense probably benign 0.03
R2938:Xpo4 UTSW 14 57604440 missense probably benign 0.03
R4066:Xpo4 UTSW 14 57588054 missense probably benign 0.07
R4086:Xpo4 UTSW 14 57643033 intron probably benign
R4373:Xpo4 UTSW 14 57591022 nonsense probably null
R4620:Xpo4 UTSW 14 57630325 missense probably damaging 1.00
R4703:Xpo4 UTSW 14 57590108 missense probably benign 0.01
R4755:Xpo4 UTSW 14 57618181 missense probably benign 0.01
R4831:Xpo4 UTSW 14 57590102 missense probably damaging 1.00
R4905:Xpo4 UTSW 14 57638289 missense possibly damaging 0.70
R4943:Xpo4 UTSW 14 57638240 missense possibly damaging 0.68
R5074:Xpo4 UTSW 14 57584641 missense probably benign 0.02
R5279:Xpo4 UTSW 14 57613409 missense probably benign 0.37
R5375:Xpo4 UTSW 14 57638307 missense probably damaging 0.99
R5690:Xpo4 UTSW 14 57590989 missense probably benign 0.03
R5936:Xpo4 UTSW 14 57643499 missense probably benign
R6393:Xpo4 UTSW 14 57638313 missense probably damaging 1.00
R6824:Xpo4 UTSW 14 57613403 missense probably damaging 1.00
R6893:Xpo4 UTSW 14 57582310 missense probably benign
R6923:Xpo4 UTSW 14 57603711 missense probably benign 0.19
R7028:Xpo4 UTSW 14 57597051 missense probably benign 0.22
R7442:Xpo4 UTSW 14 57630223 missense probably benign 0.00
R7469:Xpo4 UTSW 14 57597979 missense probably benign
R7490:Xpo4 UTSW 14 57602621 frame shift probably null
R7622:Xpo4 UTSW 14 57597011 missense possibly damaging 0.94
R7667:Xpo4 UTSW 14 57589959 missense probably damaging 0.97
R7789:Xpo4 UTSW 14 57613349 missense probably benign 0.00
R8000:Xpo4 UTSW 14 57589946 missense probably damaging 1.00
R8372:Xpo4 UTSW 14 57597884 critical splice donor site probably null
R8395:Xpo4 UTSW 14 57648467 missense probably benign 0.01
R8420:Xpo4 UTSW 14 57604456 missense probably damaging 0.99
R8836:Xpo4 UTSW 14 57664910 missense probably benign 0.03
R8841:Xpo4 UTSW 14 57597956 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTCATCTACCCATCAACTCAGAGG -3'
(R):5'- AGAAATTGACAGTTGCTGCAC -3'

Sequencing Primer
(F):5'- TCTACCCATCAACTCAGAGGTTATG -3'
(R):5'- CTGCACTTCATCTTGAAATTAGCAGG -3'
Posted On2019-12-20