Incidental Mutation 'R8013:Cog1'
ID617015
Institutional Source Beutler Lab
Gene Symbol Cog1
Ensembl Gene ENSMUSG00000018661
Gene Namecomponent of oligomeric golgi complex 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.870) question?
Stock #R8013 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location113649169-113667054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113656164 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 528 (D528G)
Ref Sequence ENSEMBL: ENSMUSP00000018805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018805] [ENSMUST00000063776] [ENSMUST00000148736] [ENSMUST00000152653]
Predicted Effect probably damaging
Transcript: ENSMUST00000018805
AA Change: D528G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018805
Gene: ENSMUSG00000018661
AA Change: D528G

DomainStartEndE-ValueType
Pfam:Vps51 12 93 1.5e-17 PFAM
low complexity region 95 110 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 518 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063776
SMART Domains Protein: ENSMUSP00000068394
Gene: ENSMUSG00000018661

DomainStartEndE-ValueType
Pfam:Vps51 12 93 4.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134418
Predicted Effect probably benign
Transcript: ENSMUST00000137878
Predicted Effect probably benign
Transcript: ENSMUST00000142069
Predicted Effect probably benign
Transcript: ENSMUST00000148736
Predicted Effect probably benign
Transcript: ENSMUST00000152653
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. It is thought that this protein is required for steps in the normal medial and trans Golgi-associated processing of glycoconjugates and plays a role in the organization of the Golgi-localized complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,328,870 V1138G probably damaging Het
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Ahnak A G 19: 9,009,335 D2661G unknown Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Baz2a C T 10: 128,125,288 R1627C probably benign Het
Baz2a T G 10: 128,125,292 V1628G possibly damaging Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna1g T C 11: 94,456,970 Y764C probably damaging Het
Casr G A 16: 36,509,644 L443F probably benign Het
Cfap43 T A 19: 47,773,109 I849F probably damaging Het
Cntn3 A T 6: 102,199,317 H812Q probably benign Het
Depdc5 C T 5: 32,973,842 T1229M probably benign Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Disp2 T A 2: 118,789,682 Y298* probably null Het
Dock2 A C 11: 34,705,850 I393S probably damaging Het
Dtd1 A G 2: 144,617,332 D92G probably damaging Het
Eef2 T A 10: 81,178,196 V121D probably damaging Het
Eml1 T A 12: 108,521,679 I550N probably benign Het
Entpd7 A G 19: 43,728,055 D496G probably benign Het
Ets2 T A 16: 95,716,100 L292Q probably damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Farp1 T A 14: 121,242,401 I368N probably damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fbn2 T C 18: 58,104,081 T617A possibly damaging Het
Fbxo38 T C 18: 62,530,811 E203G possibly damaging Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Grsf1 A G 5: 88,675,756 probably null Het
Hephl1 T A 9: 15,054,609 D1016V possibly damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Krt78 T C 15: 101,948,542 R377G probably damaging Het
Lama2 T C 10: 27,344,498 H457R probably benign Het
Lmnb1 T A 18: 56,708,359 Y83N probably damaging Het
Loxl4 A G 19: 42,607,676 C113R probably damaging Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Map4k4 T C 1: 39,962,212 I53T unknown Het
Myo5b C T 18: 74,760,899 Q1700* probably null Het
Npas2 T C 1: 39,338,065 F503L probably benign Het
Nrg1 A T 8: 31,949,923 S149T probably benign Het
Olfr1243 A G 2: 89,527,936 V158A probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Olfr824 T A 10: 130,126,778 K93M probably damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Prss35 T C 9: 86,755,425 S83P probably damaging Het
Psme4 G A 11: 30,804,320 M192I probably benign Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Sar1b C T 11: 51,779,794 P55L possibly damaging Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Soga1 A G 2: 157,030,786 probably null Het
Stard9 T C 2: 120,688,101 I502T probably damaging Het
Sugp2 T A 8: 70,251,642 Y610N probably damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tpr G T 1: 150,398,608 V163L probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Wdr63 T C 3: 146,081,285 T332A probably damaging Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp536 T C 7: 37,569,610 N127S probably damaging Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Cog1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02407:Cog1 APN 11 113654026 missense probably benign 0.02
IGL02631:Cog1 APN 11 113656478 nonsense probably null
IGL03258:Cog1 APN 11 113655093 nonsense probably null
R0243:Cog1 UTSW 11 113656995 unclassified probably benign
R0336:Cog1 UTSW 11 113662250 missense probably benign 0.28
R1061:Cog1 UTSW 11 113652037 missense probably benign
R1539:Cog1 UTSW 11 113652232 missense possibly damaging 0.93
R1757:Cog1 UTSW 11 113652304 missense possibly damaging 0.71
R1782:Cog1 UTSW 11 113653966 missense probably benign
R1924:Cog1 UTSW 11 113656212 missense probably benign
R2120:Cog1 UTSW 11 113649598 missense probably damaging 0.98
R2121:Cog1 UTSW 11 113649598 missense probably damaging 0.98
R2137:Cog1 UTSW 11 113659301 missense probably damaging 1.00
R3809:Cog1 UTSW 11 113655010 missense probably benign
R4042:Cog1 UTSW 11 113661010 missense probably damaging 1.00
R4287:Cog1 UTSW 11 113654027 missense probably damaging 0.99
R4679:Cog1 UTSW 11 113652290 missense probably damaging 1.00
R4716:Cog1 UTSW 11 113657097 missense probably damaging 1.00
R4774:Cog1 UTSW 11 113657427 missense possibly damaging 0.84
R6575:Cog1 UTSW 11 113656061 missense probably benign 0.36
R7026:Cog1 UTSW 11 113649589 missense probably damaging 1.00
R7233:Cog1 UTSW 11 113649730 missense probably damaging 1.00
R8014:Cog1 UTSW 11 113656164 missense probably damaging 1.00
R8027:Cog1 UTSW 11 113652389 missense probably damaging 1.00
Z1176:Cog1 UTSW 11 113651982 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCATGTCCACTTTGAGCAG -3'
(R):5'- ACTTCTTCAATGGTGCACAGC -3'

Sequencing Primer
(F):5'- GTCCACTTTGAGCAGAACATGTC -3'
(R):5'- TCAATGGTGCACAGCTCTGC -3'
Posted On2020-01-23