Incidental Mutation 'R8013:Grsf1'
ID616992
Institutional Source Beutler Lab
Gene Symbol Grsf1
Ensembl Gene ENSMUSG00000044221
Gene NameG-rich RNA sequence binding factor 1
SynonymsD5Wsu31e
MMRRC Submission
Accession Numbers

Genbank: NM_178700; MGI: 106479

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8013 (G1)
Quality Score178.009
Status Not validated
Chromosome5
Chromosomal Location88659448-88676171 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 88675756 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078945] [ENSMUST00000113234] [ENSMUST00000133532] [ENSMUST00000150438] [ENSMUST00000153565]
Predicted Effect probably null
Transcript: ENSMUST00000078945
SMART Domains Protein: ENSMUSP00000077972
Gene: ENSMUSG00000044221

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
low complexity region 64 101 N/A INTRINSIC
low complexity region 124 139 N/A INTRINSIC
RRM 150 224 1.65e-6 SMART
RRM 250 321 1.79e-11 SMART
RRM 401 471 1.54e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113234
SMART Domains Protein: ENSMUSP00000108860
Gene: ENSMUSG00000044221

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
RRM 33 107 1.65e-6 SMART
RRM 133 204 1.79e-11 SMART
RRM 284 354 1.54e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133532
SMART Domains Protein: ENSMUSP00000114732
Gene: ENSMUSG00000044221

DomainStartEndE-ValueType
Blast:RRM 1 26 6e-11 BLAST
PDB:2LMI|A 1 46 3e-26 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000150438
Predicted Effect probably benign
Transcript: ENSMUST00000153565
SMART Domains Protein: ENSMUSP00000123051
Gene: ENSMUSG00000044221

DomainStartEndE-ValueType
internal_repeat_1 2 33 5.45e-5 PROSPERO
RRM 52 123 1.79e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cellular protein that binds RNAs containing the G-rich element. The protein is localized in the cytoplasm, and has been shown to stimulate translation of viral mRNAs in vitro. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,328,870 V1138G probably damaging Het
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Ahnak A G 19: 9,009,335 D2661G unknown Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Baz2a C T 10: 128,125,288 R1627C probably benign Het
Baz2a T G 10: 128,125,292 V1628G possibly damaging Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna1g T C 11: 94,456,970 Y764C probably damaging Het
Casr G A 16: 36,509,644 L443F probably benign Het
Cfap43 T A 19: 47,773,109 I849F probably damaging Het
Cntn3 A T 6: 102,199,317 H812Q probably benign Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Depdc5 C T 5: 32,973,842 T1229M probably benign Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Disp2 T A 2: 118,789,682 Y298* probably null Het
Dock2 A C 11: 34,705,850 I393S probably damaging Het
Dtd1 A G 2: 144,617,332 D92G probably damaging Het
Eef2 T A 10: 81,178,196 V121D probably damaging Het
Eml1 T A 12: 108,521,679 I550N probably benign Het
Entpd7 A G 19: 43,728,055 D496G probably benign Het
Ets2 T A 16: 95,716,100 L292Q probably damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Farp1 T A 14: 121,242,401 I368N probably damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fbn2 T C 18: 58,104,081 T617A possibly damaging Het
Fbxo38 T C 18: 62,530,811 E203G possibly damaging Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Hephl1 T A 9: 15,054,609 D1016V possibly damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Krt78 T C 15: 101,948,542 R377G probably damaging Het
Lama2 T C 10: 27,344,498 H457R probably benign Het
Lmnb1 T A 18: 56,708,359 Y83N probably damaging Het
Loxl4 A G 19: 42,607,676 C113R probably damaging Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Map4k4 T C 1: 39,962,212 I53T unknown Het
Myo5b C T 18: 74,760,899 Q1700* probably null Het
Npas2 T C 1: 39,338,065 F503L probably benign Het
Nrg1 A T 8: 31,949,923 S149T probably benign Het
Olfr1243 A G 2: 89,527,936 V158A probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Olfr824 T A 10: 130,126,778 K93M probably damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Prss35 T C 9: 86,755,425 S83P probably damaging Het
Psme4 G A 11: 30,804,320 M192I probably benign Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Sar1b C T 11: 51,779,794 P55L possibly damaging Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Soga1 A G 2: 157,030,786 probably null Het
Stard9 T C 2: 120,688,101 I502T probably damaging Het
Sugp2 T A 8: 70,251,642 Y610N probably damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tpr G T 1: 150,398,608 V163L probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Wdr63 T C 3: 146,081,285 T332A probably damaging Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp536 T C 7: 37,569,610 N127S probably damaging Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Grsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Grsf1 APN 5 88670278 missense probably damaging 1.00
IGL01505:Grsf1 APN 5 88672749 nonsense probably null
IGL02108:Grsf1 APN 5 88665903 missense probably benign 0.35
IGL02116:Grsf1 APN 5 88670174 critical splice donor site probably null
IGL02713:Grsf1 APN 5 88672730 missense probably damaging 1.00
IGL02881:Grsf1 APN 5 88673830 missense probably damaging 1.00
R0336:Grsf1 UTSW 5 88663153 missense probably damaging 0.96
R1381:Grsf1 UTSW 5 88665864 missense probably benign 0.10
R1398:Grsf1 UTSW 5 88665847 missense probably benign 0.03
R2136:Grsf1 UTSW 5 88672658 missense probably benign 0.05
R2398:Grsf1 UTSW 5 88673836 missense probably damaging 1.00
R4181:Grsf1 UTSW 5 88664156 missense probably benign 0.00
R4182:Grsf1 UTSW 5 88664156 missense probably benign 0.00
R4183:Grsf1 UTSW 5 88664156 missense probably benign 0.00
R4184:Grsf1 UTSW 5 88664156 missense probably benign 0.00
R5315:Grsf1 UTSW 5 88673775 start gained probably benign
R6246:Grsf1 UTSW 5 88662592 missense possibly damaging 0.81
R7359:Grsf1 UTSW 5 88665564 splice site probably null
R7381:Grsf1 UTSW 5 88665807 missense probably benign 0.02
R7430:Grsf1 UTSW 5 88663227 missense possibly damaging 0.67
R7703:Grsf1 UTSW 5 88671291 missense probably damaging 1.00
R7838:Grsf1 UTSW 5 88675664 start gained probably benign
YA93:Grsf1 UTSW 5 88673735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGACTCGGAGGGAAC -3'
(R):5'- TGCTGCTACTCCTCGGGG -3'

Sequencing Primer
(F):5'- CCAGACTCGGAGGGAACAAAAC -3'
(R):5'- AGGCTGGCGGGTCCCAT -3'
Posted On2020-01-23