Incidental Mutation 'R8030:Efcab14'
ID617881
Institutional Source Beutler Lab
Gene Symbol Efcab14
Ensembl Gene ENSMUSG00000034210
Gene NameEF-hand calcium binding domain 14
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8030 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location115737744-115777327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115766402 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 390 (Q390R)
Ref Sequence ENSEMBL: ENSMUSP00000074025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074425] [ENSMUST00000106522] [ENSMUST00000106524] [ENSMUST00000106525]
Predicted Effect probably benign
Transcript: ENSMUST00000074425
AA Change: Q390R

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074025
Gene: ENSMUSG00000034210
AA Change: Q390R

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1fi6a_ 425 498 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106522
AA Change: Q390R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102132
Gene: ENSMUSG00000034210
AA Change: Q390R

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106524
AA Change: Q326R

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102134
Gene: ENSMUSG00000034210
AA Change: Q326R

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1hqva_ 360 418 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106525
AA Change: Q390R

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102135
Gene: ENSMUSG00000034210
AA Change: Q390R

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1hqva_ 424 482 3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B09Rik A G 9: 14,761,674 S98P probably benign Het
2410089E03Rik G T 15: 8,230,303 G2383V probably damaging Het
Abca9 C T 11: 110,120,708 V1170I probably benign Het
Acacb A G 5: 114,233,167 T1786A probably damaging Het
Acmsd T C 1: 127,749,161 I141T possibly damaging Het
Akr1c12 A G 13: 4,272,245 V266A possibly damaging Het
Arhgef18 A T 8: 3,439,600 I311F probably damaging Het
Armc2 T A 10: 41,966,742 N355I possibly damaging Het
Armh1 T A 4: 117,229,987 K160N probably benign Het
Asic1 A T 15: 99,694,841 T236S possibly damaging Het
Avl9 T A 6: 56,741,422 D424E probably damaging Het
Cbfa2t2 A T 2: 154,515,896 Q197L probably damaging Het
Ccdc136 T C 6: 29,417,142 V654A probably benign Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cracr2a A G 6: 127,611,423 K182E probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Dsc1 A T 18: 20,089,571 S615T probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Eif4ebp2 G A 10: 61,435,046 A68V probably damaging Het
Fam81a A G 9: 70,102,909 S149P probably benign Het
Ffar4 A G 19: 38,107,391 I193V possibly damaging Het
Flvcr2 T A 12: 85,798,538 V377D probably damaging Het
Fscn1 C T 5: 142,961,001 R185C possibly damaging Het
Gucy1b2 C T 14: 62,392,870 S809N probably benign Het
H60b T A 10: 22,287,121 N198K probably damaging Het
Helz2 A T 2: 181,237,896 F643Y possibly damaging Het
Kif28 A G 1: 179,699,064 V846A probably benign Het
Kirrel C A 3: 87,097,775 G89W probably damaging Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Mb21d2 A G 16: 28,827,803 F473S probably damaging Het
Mcrip2 G A 17: 25,864,332 Q111* probably null Het
Msh5 A G 17: 35,029,748 Y741H possibly damaging Het
Myo7b A G 18: 31,998,082 I544T probably damaging Het
Nav1 T C 1: 135,537,239 E276G probably damaging Het
Nr2f1 T C 13: 78,195,446 N233S probably benign Het
Nrip2 A T 6: 128,406,521 D124V possibly damaging Het
Olfr1008 T A 2: 85,689,719 C97S probably damaging Het
Olfr1042 C T 2: 86,160,242 V43I probably benign Het
Panx2 G T 15: 89,068,079 A250S probably damaging Het
Pdc T C 1: 150,333,213 L149P probably damaging Het
Pex5l T A 3: 32,954,419 I445F possibly damaging Het
Pigc T C 1: 161,970,547 F33L probably damaging Het
Pkp2 A T 16: 16,246,910 M433L probably benign Het
Rbfox2 A G 15: 77,085,576 probably null Het
Rd3l A G 12: 111,980,150 L64P possibly damaging Het
Rnf220 A G 4: 117,277,828 Y409H probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Sel1l2 T C 2: 140,241,018 T567A probably damaging Het
Slc22a8 T C 19: 8,610,007 I477T probably damaging Het
Sltm C T 9: 70,585,979 R753* probably null Het
Specc1l T A 10: 75,248,555 M687K probably damaging Het
Spock3 T G 8: 63,352,198 C338G probably damaging Het
Ssh2 C A 11: 77,454,506 Q1106K probably benign Het
Sycp2l A G 13: 41,172,670 M251V not run Het
Tdrd5 C A 1: 156,270,595 E711* probably null Het
Thop1 T C 10: 81,075,616 M112T possibly damaging Het
Tln1 C T 4: 43,535,737 probably null Het
Ttc28 A C 5: 111,286,056 I2319L possibly damaging Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Txndc8 T C 4: 57,984,178 E151G probably damaging Het
Ubr1 T C 2: 120,934,374 E533G probably damaging Het
Zscan4f A G 7: 11,401,363 H232R probably benign Het
Other mutations in Efcab14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02232:Efcab14 APN 4 115760064 splice site probably benign
IGL02300:Efcab14 APN 4 115758896 critical splice donor site probably null
IGL02598:Efcab14 APN 4 115740434 nonsense probably null
IGL02680:Efcab14 APN 4 115740418 missense probably damaging 1.00
IGL03066:Efcab14 APN 4 115738804 missense probably benign 0.12
R0123:Efcab14 UTSW 4 115740531 missense probably damaging 1.00
R0134:Efcab14 UTSW 4 115740531 missense probably damaging 1.00
R1275:Efcab14 UTSW 4 115756473 missense probably damaging 1.00
R1481:Efcab14 UTSW 4 115756517 missense probably benign 0.07
R1590:Efcab14 UTSW 4 115756549 splice site probably benign
R1694:Efcab14 UTSW 4 115746539 missense possibly damaging 0.82
R1768:Efcab14 UTSW 4 115752919 critical splice acceptor site probably null
R1769:Efcab14 UTSW 4 115752991 missense probably damaging 1.00
R3887:Efcab14 UTSW 4 115738660 start codon destroyed probably null 1.00
R4158:Efcab14 UTSW 4 115740397 missense probably damaging 0.99
R4160:Efcab14 UTSW 4 115740397 missense probably damaging 0.99
R5584:Efcab14 UTSW 4 115764597 missense possibly damaging 0.49
R5690:Efcab14 UTSW 4 115760047 missense possibly damaging 0.71
R5796:Efcab14 UTSW 4 115746583 missense probably damaging 0.99
R5945:Efcab14 UTSW 4 115756467 missense probably damaging 1.00
R6445:Efcab14 UTSW 4 115756471 missense possibly damaging 0.74
R6761:Efcab14 UTSW 4 115738827 missense probably damaging 1.00
R7564:Efcab14 UTSW 4 115759962 missense probably benign 0.33
X0018:Efcab14 UTSW 4 115766486 missense probably damaging 0.99
Z1177:Efcab14 UTSW 4 115738702 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTTAGTGTAGTCCCGATC -3'
(R):5'- ACCTGAATCATCTCTCTAGTTCATTAG -3'

Sequencing Primer
(F):5'- GCTTATCTGCACACATCCTTCAG -3'
(R):5'- TGCTAGAAATCCCAGGCA -3'
Posted On2020-01-23