Incidental Mutation 'R8030:Pex5l'
ID617877
Institutional Source Beutler Lab
Gene Symbol Pex5l
Ensembl Gene ENSMUSG00000027674
Gene Nameperoxisomal biogenesis factor 5-like
SynonymsPex2, PXR2, TRIP8b, 1700016J08Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.597) question?
Stock #R8030 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location32949408-33143247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32954419 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 445 (I445F)
Ref Sequence ENSEMBL: ENSMUSP00000142008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078226] [ENSMUST00000108221] [ENSMUST00000108224] [ENSMUST00000108225] [ENSMUST00000108226] [ENSMUST00000192093] [ENSMUST00000193289] [ENSMUST00000193681] [ENSMUST00000194016]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078226
AA Change: I410F

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077353
Gene: ENSMUSG00000027674
AA Change: I410F

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108221
AA Change: I139F

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103856
Gene: ENSMUSG00000027674
AA Change: I139F

DomainStartEndE-ValueType
TPR 78 111 6.95e-4 SMART
Blast:TPR 112 145 2e-14 BLAST
TPR 192 225 3.19e-3 SMART
TPR 226 259 3.47e-4 SMART
TPR 260 293 1.1e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108224
AA Change: I386F

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103859
Gene: ENSMUSG00000027674
AA Change: I386F

DomainStartEndE-ValueType
low complexity region 88 104 N/A INTRINSIC
low complexity region 190 204 N/A INTRINSIC
TPR 325 358 6.95e-4 SMART
Blast:TPR 359 392 2e-14 BLAST
TPR 439 472 3.19e-3 SMART
TPR 473 506 3.47e-4 SMART
TPR 507 540 1.1e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108225
AA Change: I410F

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103860
Gene: ENSMUSG00000027674
AA Change: I410F

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108226
AA Change: I362F

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103861
Gene: ENSMUSG00000027674
AA Change: I362F

DomainStartEndE-ValueType
low complexity region 65 81 N/A INTRINSIC
low complexity region 166 180 N/A INTRINSIC
TPR 301 334 6.95e-4 SMART
Blast:TPR 335 368 2e-14 BLAST
TPR 415 448 3.19e-3 SMART
TPR 449 482 3.47e-4 SMART
TPR 483 516 1.1e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192093
AA Change: I410F

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141387
Gene: ENSMUSG00000027674
AA Change: I410F

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000193289
AA Change: I445F

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142008
Gene: ENSMUSG00000027674
AA Change: I445F

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000193681
AA Change: I445F

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141454
Gene: ENSMUSG00000027674
AA Change: I445F

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194016
AA Change: I445F

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142196
Gene: ENSMUSG00000027674
AA Change: I445F

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation lacking isoform b exhibit exhibit reduced hyperpolarization-activated current in CA1 pyramidal neuron, impaired motor learning, impaired nest-building, decreased startle reflex, and decreased depression-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B09Rik A G 9: 14,761,674 S98P probably benign Het
2410089E03Rik G T 15: 8,230,303 G2383V probably damaging Het
Abca9 C T 11: 110,120,708 V1170I probably benign Het
Acacb A G 5: 114,233,167 T1786A probably damaging Het
Acmsd T C 1: 127,749,161 I141T possibly damaging Het
Akr1c12 A G 13: 4,272,245 V266A possibly damaging Het
Arhgef18 A T 8: 3,439,600 I311F probably damaging Het
Armc2 T A 10: 41,966,742 N355I possibly damaging Het
Armh1 T A 4: 117,229,987 K160N probably benign Het
Asic1 A T 15: 99,694,841 T236S possibly damaging Het
Avl9 T A 6: 56,741,422 D424E probably damaging Het
Cbfa2t2 A T 2: 154,515,896 Q197L probably damaging Het
Ccdc136 T C 6: 29,417,142 V654A probably benign Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cracr2a A G 6: 127,611,423 K182E probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Dsc1 A T 18: 20,089,571 S615T probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab14 A G 4: 115,766,402 Q390R probably benign Het
Eif4ebp2 G A 10: 61,435,046 A68V probably damaging Het
Fam81a A G 9: 70,102,909 S149P probably benign Het
Ffar4 A G 19: 38,107,391 I193V possibly damaging Het
Flvcr2 T A 12: 85,798,538 V377D probably damaging Het
Fscn1 C T 5: 142,961,001 R185C possibly damaging Het
Gucy1b2 C T 14: 62,392,870 S809N probably benign Het
H60b T A 10: 22,287,121 N198K probably damaging Het
Helz2 A T 2: 181,237,896 F643Y possibly damaging Het
Kif28 A G 1: 179,699,064 V846A probably benign Het
Kirrel C A 3: 87,097,775 G89W probably damaging Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Mb21d2 A G 16: 28,827,803 F473S probably damaging Het
Mcrip2 G A 17: 25,864,332 Q111* probably null Het
Msh5 A G 17: 35,029,748 Y741H possibly damaging Het
Myo7b A G 18: 31,998,082 I544T probably damaging Het
Nav1 T C 1: 135,537,239 E276G probably damaging Het
Nr2f1 T C 13: 78,195,446 N233S probably benign Het
Nrip2 A T 6: 128,406,521 D124V possibly damaging Het
Olfr1008 T A 2: 85,689,719 C97S probably damaging Het
Olfr1042 C T 2: 86,160,242 V43I probably benign Het
Panx2 G T 15: 89,068,079 A250S probably damaging Het
Pdc T C 1: 150,333,213 L149P probably damaging Het
Pigc T C 1: 161,970,547 F33L probably damaging Het
Pkp2 A T 16: 16,246,910 M433L probably benign Het
Rbfox2 A G 15: 77,085,576 probably null Het
Rd3l A G 12: 111,980,150 L64P possibly damaging Het
Rnf220 A G 4: 117,277,828 Y409H probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Sel1l2 T C 2: 140,241,018 T567A probably damaging Het
Slc22a8 T C 19: 8,610,007 I477T probably damaging Het
Sltm C T 9: 70,585,979 R753* probably null Het
Specc1l T A 10: 75,248,555 M687K probably damaging Het
Spock3 T G 8: 63,352,198 C338G probably damaging Het
Ssh2 C A 11: 77,454,506 Q1106K probably benign Het
Sycp2l A G 13: 41,172,670 M251V not run Het
Tdrd5 C A 1: 156,270,595 E711* probably null Het
Thop1 T C 10: 81,075,616 M112T possibly damaging Het
Tln1 C T 4: 43,535,737 probably null Het
Ttc28 A C 5: 111,286,056 I2319L possibly damaging Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Txndc8 T C 4: 57,984,178 E151G probably damaging Het
Ubr1 T C 2: 120,934,374 E533G probably damaging Het
Zscan4f A G 7: 11,401,363 H232R probably benign Het
Other mutations in Pex5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Pex5l APN 3 32952597 missense probably damaging 1.00
IGL01621:Pex5l APN 3 33014961 splice site probably null
IGL01813:Pex5l APN 3 33082055 missense probably benign 0.02
IGL02313:Pex5l APN 3 32992992 missense probably benign 0.22
IGL02508:Pex5l APN 3 32992902 splice site probably benign
IGL02997:Pex5l APN 3 32955842 splice site probably benign
R0195:Pex5l UTSW 3 32992953 missense possibly damaging 0.87
R0674:Pex5l UTSW 3 32952616 missense probably damaging 1.00
R0729:Pex5l UTSW 3 32954536 splice site probably benign
R1500:Pex5l UTSW 3 33014980 missense probably damaging 1.00
R1513:Pex5l UTSW 3 33015013 nonsense probably null
R1695:Pex5l UTSW 3 32954382 missense probably benign 0.28
R1850:Pex5l UTSW 3 32950876 splice site probably null
R2165:Pex5l UTSW 3 32953132 synonymous probably null
R2679:Pex5l UTSW 3 33082052 missense probably benign 0.02
R2880:Pex5l UTSW 3 32993003 critical splice acceptor site probably null
R2881:Pex5l UTSW 3 32993003 critical splice acceptor site probably null
R3766:Pex5l UTSW 3 33007178 missense probably benign 0.01
R3780:Pex5l UTSW 3 32950844 missense probably damaging 1.00
R3934:Pex5l UTSW 3 33007172 missense probably damaging 1.00
R3975:Pex5l UTSW 3 33015015 missense probably damaging 0.99
R4285:Pex5l UTSW 3 33007187 missense probably damaging 1.00
R4825:Pex5l UTSW 3 32992985 missense probably damaging 0.99
R4855:Pex5l UTSW 3 33142840 splice site probably benign
R4868:Pex5l UTSW 3 32952490 missense probably damaging 1.00
R5135:Pex5l UTSW 3 32955831 missense probably damaging 1.00
R5217:Pex5l UTSW 3 33007328 splice site probably null
R5223:Pex5l UTSW 3 32958796 missense probably damaging 1.00
R5362:Pex5l UTSW 3 32992916 missense probably damaging 1.00
R5398:Pex5l UTSW 3 32952490 missense probably damaging 1.00
R5829:Pex5l UTSW 3 33005990 missense probably benign 0.00
R6731:Pex5l UTSW 3 32958798 missense probably damaging 1.00
R7180:Pex5l UTSW 3 33024691 splice site probably null
R7452:Pex5l UTSW 3 33004318 missense probably benign 0.02
R7549:Pex5l UTSW 3 33082035 missense probably benign 0.04
R7563:Pex5l UTSW 3 32954476 missense probably damaging 0.98
R7757:Pex5l UTSW 3 33082151 start gained probably benign
R8242:Pex5l UTSW 3 33006035 missense probably benign 0.01
Z1177:Pex5l UTSW 3 33007159 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGCCATCATGCTGGTTATG -3'
(R):5'- AAAACACTCTTTGGTCTGGGTTTTC -3'

Sequencing Primer
(F):5'- ACACCAGCCTGTAACTGTGTG -3'
(R):5'- TGGGTTTTCATTTGAAGAAATAAAGC -3'
Posted On2020-01-23