Incidental Mutation 'R8072:Loxl4'
ID620314
Institutional Source Beutler Lab
Gene Symbol Loxl4
Ensembl Gene ENSMUSG00000025185
Gene Namelysyl oxidase-like 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8072 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location42593982-42612813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42607582 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 144 (E144G)
Ref Sequence ENSEMBL: ENSMUSP00000125803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026190] [ENSMUST00000164786] [ENSMUST00000166128] [ENSMUST00000171432]
Predicted Effect probably benign
Transcript: ENSMUST00000026190
AA Change: E144G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026190
Gene: ENSMUSG00000025185
AA Change: E144G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 312 412 2.6e-41 SMART
SR 422 530 5.41e-30 SMART
Pfam:Lysyl_oxidase 534 737 1.3e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164786
AA Change: E144G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125803
Gene: ENSMUSG00000025185
AA Change: E144G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 313 413 2.6e-41 SMART
SR 423 531 5.41e-30 SMART
Pfam:Lysyl_oxidase 535 735 1.8e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166128
SMART Domains Protein: ENSMUSP00000126552
Gene: ENSMUSG00000025185

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
SR 46 147 1.57e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171432
AA Change: E144G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126686
Gene: ENSMUSG00000025185
AA Change: E144G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 312 412 2.6e-41 SMART
SR 422 530 5.41e-30 SMART
Pfam:Lysyl_oxidase 534 737 1.3e-113 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysyl oxidase gene family. The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in collagens and elastin. A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. The N-terminus is poorly conserved and may impart additional roles in developmental regulation, senescence, tumor suppression, cell growth control, and chemotaxis to each member of the family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,574 S2146P probably benign Het
Acad9 G A 3: 36,075,255 V160I probably benign Het
Ace T C 11: 105,972,959 V411A probably damaging Het
Ankrd66 T C 17: 43,543,635 E2G possibly damaging Het
Apol6 A T 15: 77,051,103 T191S probably benign Het
Arhgef17 T A 7: 100,881,797 T352S probably benign Het
Atad2 C T 15: 58,099,978 R1081Q possibly damaging Het
Atg3 G T 16: 45,187,685 V297F probably damaging Het
Atp9b A C 18: 80,765,061 S663A Het
Col10a1 G T 10: 34,390,667 V16F unknown Het
Col3a1 G A 1: 45,321,574 V55I unknown Het
Ctns T C 11: 73,191,746 T53A probably benign Het
Cyp2b23 A T 7: 26,666,006 I468N probably damaging Het
Dcbld2 G A 16: 58,463,097 W565* probably null Het
Esco2 A T 14: 65,832,681 N16K probably benign Het
Fggy A G 4: 95,844,157 N462D possibly damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gm4846 T C 1: 166,494,672 T109A probably benign Het
H2-M11 G T 17: 36,548,134 V189L probably benign Het
Hmcn1 T A 1: 150,656,505 T3175S possibly damaging Het
Hook2 G A 8: 84,994,491 V184M probably benign Het
Hspa4l A T 3: 40,786,746 D730V probably damaging Het
Igkv4-68 C T 6: 69,305,129 M19I probably benign Het
Igsf9b C A 9: 27,317,364 T140N possibly damaging Het
Kcnj1 G A 9: 32,397,297 R339Q probably damaging Het
Lcn8 T G 2: 25,655,172 L118W probably damaging Het
Lin28a A G 4: 134,018,142 F47L possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgprb1 C A 7: 48,448,147 E6* probably null Het
Mthfsd A C 8: 121,098,816 Y339D probably damaging Het
Mup11 A T 4: 60,659,778 F153L probably damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Plpp7 G T 2: 32,096,109 A100S probably benign Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprd A G 4: 76,086,036 F161L probably benign Het
Pwp2 G A 10: 78,172,096 A875V possibly damaging Het
Rhd A G 4: 134,884,149 T207A possibly damaging Het
Sh2d3c C T 2: 32,753,138 R778C probably damaging Het
Slc34a3 A C 2: 25,229,277 V527G probably benign Het
Smad2 T C 18: 76,286,951 probably null Het
Sp110 GTACT GTACTACT 1: 85,587,486 probably benign Het
Spata21 C T 4: 141,112,006 Q611* probably null Het
Taf4b A G 18: 14,821,528 T554A probably benign Het
Tial1 T C 7: 128,442,470 T107A unknown Het
Ubxn6 C A 17: 56,073,195 R42L probably benign Het
Vmn2r90 A T 17: 17,726,880 N473I probably damaging Het
Ythdc1 T A 5: 86,821,274 Y351* probably null Het
Other mutations in Loxl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Loxl4 APN 19 42597549 missense probably damaging 1.00
IGL02063:Loxl4 APN 19 42608339 missense probably benign 0.03
IGL02490:Loxl4 APN 19 42604830 missense probably benign
IGL02498:Loxl4 APN 19 42604973 missense probably benign 0.27
IGL03107:Loxl4 APN 19 42605279 missense probably benign 0.12
IGL03296:Loxl4 APN 19 42598823 splice site probably benign
R1145:Loxl4 UTSW 19 42608555 unclassified probably benign
R1697:Loxl4 UTSW 19 42604940 missense possibly damaging 0.86
R2126:Loxl4 UTSW 19 42603963 missense probably damaging 1.00
R2128:Loxl4 UTSW 19 42603963 missense probably damaging 1.00
R2148:Loxl4 UTSW 19 42604192 splice site probably null
R2159:Loxl4 UTSW 19 42600007 missense probably damaging 1.00
R3624:Loxl4 UTSW 19 42607576 missense probably benign 0.28
R4030:Loxl4 UTSW 19 42608359 missense probably damaging 1.00
R4181:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4302:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4700:Loxl4 UTSW 19 42607613 missense probably benign 0.07
R4701:Loxl4 UTSW 19 42607613 missense probably benign 0.07
R4719:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4724:Loxl4 UTSW 19 42608346 missense probably benign 0.23
R4750:Loxl4 UTSW 19 42605004 missense probably damaging 1.00
R4953:Loxl4 UTSW 19 42610694 unclassified probably benign
R5579:Loxl4 UTSW 19 42604290 missense probably damaging 1.00
R5840:Loxl4 UTSW 19 42598715 missense probably damaging 1.00
R5856:Loxl4 UTSW 19 42595366 missense possibly damaging 0.89
R5879:Loxl4 UTSW 19 42607627 missense probably benign 0.09
R6137:Loxl4 UTSW 19 42598793 missense probably damaging 1.00
R6180:Loxl4 UTSW 19 42608352 missense probably damaging 1.00
R6324:Loxl4 UTSW 19 42595378 missense probably benign 0.00
R6347:Loxl4 UTSW 19 42608270 missense probably damaging 1.00
R6646:Loxl4 UTSW 19 42598781 missense probably damaging 1.00
R6788:Loxl4 UTSW 19 42608353 missense probably damaging 1.00
R7045:Loxl4 UTSW 19 42606635 missense probably damaging 1.00
R8013:Loxl4 UTSW 19 42607676 missense probably damaging 1.00
R8546:Loxl4 UTSW 19 42607588 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGAGCAGTTTCTCAGGTC -3'
(R):5'- TGTCCCACCAGAGAGAAAGCAG -3'

Sequencing Primer
(F):5'- AGTTTCTCAGGTCCCACCAGG -3'
(R):5'- GAGAAAGCAGCCTCTCTCG -3'
Posted On2020-01-23