Incidental Mutation 'R0698:Arhgef11'
ID62897
Institutional Source Beutler Lab
Gene Symbol Arhgef11
Ensembl Gene ENSMUSG00000041977
Gene NameRho guanine nucleotide exchange factor (GEF) 11
SynonymsPrg, PDZ-RhoGEF
MMRRC Submission 038882-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0698 (G1)
Quality Score100
Status Not validated
Chromosome3
Chromosomal Location87617559-87738034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87733459 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 1308 (A1308S)
Ref Sequence ENSEMBL: ENSMUSP00000118123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023846] [ENSMUST00000039476] [ENSMUST00000129113] [ENSMUST00000152006]
Predicted Effect probably benign
Transcript: ENSMUST00000023846
SMART Domains Protein: ENSMUSP00000023846
Gene: ENSMUSG00000023084

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:LRR 165 191 6e-7 BLAST
LRR 219 246 4.24e-1 SMART
LRR 251 278 1.33e-1 SMART
LRR 279 306 1.98e-4 SMART
low complexity region 312 323 N/A INTRINSIC
low complexity region 329 337 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 407 414 N/A INTRINSIC
LRR 472 499 1.83e2 SMART
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039476
AA Change: A1337S

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977
AA Change: A1337S

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
RhoGEF 768 952 1.11e-65 SMART
PH 996 1111 9.49e-6 SMART
low complexity region 1153 1166 N/A INTRINSIC
low complexity region 1176 1188 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1357 1367 N/A INTRINSIC
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129113
AA Change: A1308S

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118123
Gene: ENSMUSG00000041977
AA Change: A1308S

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
RGS 313 432 3.36e-11 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 652 665 N/A INTRINSIC
RhoGEF 739 923 1.11e-65 SMART
PH 967 1082 9.49e-6 SMART
low complexity region 1124 1137 N/A INTRINSIC
low complexity region 1147 1159 N/A INTRINSIC
low complexity region 1304 1314 N/A INTRINSIC
low complexity region 1328 1338 N/A INTRINSIC
low complexity region 1449 1461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152006
SMART Domains Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174381
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. A similar protein in rat interacts with glutamate transporter EAAT4 and modulates its glutamate transport activity. Expression of the rat protein induces the reorganization of the actin cytoskeleton and its overexpression induces the formation of membrane ruffling and filopodia. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 C T 16: 35,290,082 T873M possibly damaging Het
Ap4e1 G A 2: 127,063,363 E985K probably benign Het
Arhgap18 T C 10: 26,912,629 I579T probably damaging Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
Atm T C 9: 53,515,239 E573G probably damaging Het
Baz1b T C 5: 135,198,221 V92A probably damaging Het
Cmya5 A G 13: 93,095,557 S1008P probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Cpne4 T C 9: 104,925,795 S213P probably damaging Het
Dock10 T A 1: 80,530,178 Q1672L probably damaging Het
Grm8 C T 6: 27,363,914 C534Y probably damaging Het
Ints7 A G 1: 191,594,464 M183V probably damaging Het
Invs T G 4: 48,396,364 S346A probably benign Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Lrrtm4 T C 6: 80,022,928 L441P probably damaging Het
Map4 C T 9: 110,068,788 R81* probably null Het
Med1 A G 11: 98,155,689 probably benign Het
Necab1 T C 4: 15,005,041 N141S probably benign Het
Olfr412 A T 11: 74,365,142 I158F probably benign Het
Pcdhb2 A T 18: 37,297,366 E797D probably benign Het
Pclo T C 5: 14,712,516 Y3668H unknown Het
Peg10 T A 6: 4,756,835 probably benign Het
Psd2 A G 18: 36,012,711 I723V probably benign Het
Ptprn2 C T 12: 116,722,130 R70* probably null Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab13 C T 3: 90,224,736 T69M probably damaging Het
Rpl32 T C 6: 115,805,590 N126S probably benign Het
Sis C A 3: 72,910,498 A1461S probably damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Spta1 T C 1: 174,181,104 L258P probably damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tada3 A T 6: 113,367,007 L227Q probably damaging Het
Tet2 A T 3: 133,467,384 S1706T probably benign Het
Ttc6 G A 12: 57,673,216 V858I probably benign Het
Vps13c C A 9: 67,889,723 A464E probably benign Het
Zbtb17 T C 4: 141,466,096 probably null Het
Zcchc11 T A 4: 108,555,533 M1477K probably benign Het
Zcwpw1 G A 5: 137,817,521 E429K probably benign Het
Other mutations in Arhgef11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Arhgef11 APN 3 87729503 missense probably damaging 1.00
IGL00900:Arhgef11 APN 3 87683560 missense possibly damaging 0.71
IGL01291:Arhgef11 APN 3 87733174 missense probably benign 0.00
IGL01475:Arhgef11 APN 3 87727126 splice site probably benign
IGL01599:Arhgef11 APN 3 87737046 missense probably benign
IGL02251:Arhgef11 APN 3 87683547 missense probably damaging 1.00
IGL02651:Arhgef11 APN 3 87698864 missense probably damaging 0.99
IGL02884:Arhgef11 APN 3 87728006 missense probably damaging 1.00
IGL02900:Arhgef11 APN 3 87733160 missense probably benign 0.07
IGL03017:Arhgef11 APN 3 87717060 nonsense probably null
ANU05:Arhgef11 UTSW 3 87733174 missense probably benign 0.00
R0049:Arhgef11 UTSW 3 87729193 splice site probably null
R0049:Arhgef11 UTSW 3 87729193 splice site probably null
R0129:Arhgef11 UTSW 3 87728063 missense probably damaging 1.00
R0486:Arhgef11 UTSW 3 87688852 unclassified probably null
R0701:Arhgef11 UTSW 3 87733459 missense probably benign 0.24
R0849:Arhgef11 UTSW 3 87735896 missense probably benign 0.24
R1055:Arhgef11 UTSW 3 87717118 missense probably benign 0.19
R1256:Arhgef11 UTSW 3 87727135 missense possibly damaging 0.81
R1401:Arhgef11 UTSW 3 87733469 nonsense probably null
R1543:Arhgef11 UTSW 3 87713017 missense probably benign 0.10
R1547:Arhgef11 UTSW 3 87695402 missense possibly damaging 0.87
R1564:Arhgef11 UTSW 3 87702510 missense probably benign
R1675:Arhgef11 UTSW 3 87731211 missense possibly damaging 0.84
R2082:Arhgef11 UTSW 3 87725996 missense possibly damaging 0.47
R2293:Arhgef11 UTSW 3 87727990 missense probably damaging 1.00
R4739:Arhgef11 UTSW 3 87697999 missense possibly damaging 0.47
R4930:Arhgef11 UTSW 3 87728594 missense probably damaging 1.00
R5130:Arhgef11 UTSW 3 87726014 missense possibly damaging 0.71
R5151:Arhgef11 UTSW 3 87735360 missense probably damaging 1.00
R5157:Arhgef11 UTSW 3 87728510 splice site probably null
R5203:Arhgef11 UTSW 3 87735357 missense probably damaging 1.00
R5329:Arhgef11 UTSW 3 87679752 intron probably benign
R5615:Arhgef11 UTSW 3 87722485 critical splice donor site probably null
R5646:Arhgef11 UTSW 3 87684486 missense possibly damaging 0.94
R6125:Arhgef11 UTSW 3 87729602 missense probably damaging 1.00
R6242:Arhgef11 UTSW 3 87728078 missense probably benign
R6543:Arhgef11 UTSW 3 87733408 missense probably benign 0.09
R6801:Arhgef11 UTSW 3 87735852 missense possibly damaging 0.53
R6939:Arhgef11 UTSW 3 87686920 missense probably damaging 1.00
R7008:Arhgef11 UTSW 3 87729218 missense possibly damaging 0.92
R7155:Arhgef11 UTSW 3 87709572 nonsense probably null
R7169:Arhgef11 UTSW 3 87727448 missense possibly damaging 0.79
R7325:Arhgef11 UTSW 3 87713292 missense possibly damaging 0.62
R7392:Arhgef11 UTSW 3 87717175 critical splice donor site probably null
R7683:Arhgef11 UTSW 3 87722383 missense probably damaging 0.98
R7875:Arhgef11 UTSW 3 87684501 missense probably damaging 1.00
R7912:Arhgef11 UTSW 3 87733222 missense probably damaging 1.00
R8028:Arhgef11 UTSW 3 87735552 missense probably benign
R8081:Arhgef11 UTSW 3 87725642 missense probably damaging 1.00
R8118:Arhgef11 UTSW 3 87735857 missense probably damaging 1.00
R8207:Arhgef11 UTSW 3 87698775 missense possibly damaging 0.71
R8290:Arhgef11 UTSW 3 87725968 missense probably damaging 1.00
X0011:Arhgef11 UTSW 3 87722406 missense probably benign
Z1176:Arhgef11 UTSW 3 87735462 missense not run
Predicted Primers PCR Primer
(F):5'- GCGAGCCTGAAGATGACCTTACAC -3'
(R):5'- ACACACAGACGGAAGGACTTTGAAC -3'

Sequencing Primer
(F):5'- GTCGTCAGCATTACCTCTCAC -3'
(R):5'- CGGAAGGACTTTGAACCTTGC -3'
Posted On2013-07-30