Incidental Mutation 'R8080:Slc35e1'
ID629289
Institutional Source Beutler Lab
Gene Symbol Slc35e1
Ensembl Gene ENSMUSG00000019731
Gene Namesolute carrier family 35, member E1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R8080 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location72480641-72492614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72492186 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 134 (P134L)
Ref Sequence ENSEMBL: ENSMUSP00000115754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058534] [ENSMUST00000152080]
Predicted Effect probably benign
Transcript: ENSMUST00000058534
SMART Domains Protein: ENSMUSP00000058697
Gene: ENSMUSG00000045248

DomainStartEndE-ValueType
TFS2N 12 86 6.67e-21 SMART
low complexity region 93 108 N/A INTRINSIC
Pfam:Med26_M 177 405 3e-80 PFAM
Pfam:Med26_C 407 586 5.1e-91 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152080
AA Change: P134L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115754
Gene: ENSMUSG00000019731
AA Change: P134L

DomainStartEndE-ValueType
Pfam:TPT 28 333 8.3e-95 PFAM
Pfam:EamA 188 334 7.1e-10 PFAM
Meta Mutation Damage Score 0.6674 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 94.9%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,133,074 Q277R probably damaging Het
Anapc5 T C 5: 122,807,338 N226D probably damaging Het
Bcl2l11 T C 2: 128,128,666 C12R probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Brca2 A T 5: 150,539,892 E1040D probably benign Het
Cdca2 G A 14: 67,677,555 Q752* probably null Het
Cntn2 T C 1: 132,521,798 D635G probably damaging Het
Cntnap5b A T 1: 100,072,203 I229F probably benign Het
Ctr9 G A 7: 111,051,567 E900K possibly damaging Het
Dmbt1 A G 7: 131,088,770 Y911C unknown Het
Egflam T A 15: 7,398,080 D2V probably benign Het
Enpep A T 3: 129,299,134 N505K probably damaging Het
Fam13a A G 6: 58,956,805 S267P probably damaging Het
Fam172a T A 13: 78,006,446 L316Q probably damaging Het
Fancc G T 13: 63,403,023 T12K Het
Fbxo3 A G 2: 104,033,667 Y89C probably damaging Het
Garem2 A G 5: 30,108,387 Y83C probably damaging Het
Gm17079 T C 14: 51,693,023 T122A Het
Gm3696 A T 14: 7,089,870 L71* probably null Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gmip A T 8: 69,816,086 T454S possibly damaging Het
Helz2 T A 2: 181,238,262 T554S probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrc A G 7: 45,336,838 E471G probably damaging Het
Hydin A G 8: 110,535,231 I2655V probably benign Het
Ighv1-64 T C 12: 115,507,843 H18R probably benign Het
Jcad A G 18: 4,649,270 Y47C probably benign Het
Jmjd4 A G 11: 59,450,353 T37A probably benign Het
Kalrn C T 16: 33,975,668 G2915S possibly damaging Het
Kdm5d T C Y: 910,742 F285L probably benign Het
Lmna A G 3: 88,486,561 F237L probably damaging Het
Med12l A G 3: 59,265,186 K1788E probably damaging Het
Mrgprb1 T C 7: 48,446,910 probably null Het
Myh1 T A 11: 67,211,402 Y840N probably benign Het
Negr1 C A 3: 157,160,720 A302E probably damaging Het
Nup188 T C 2: 30,337,033 V1206A possibly damaging Het
Nup205 T C 6: 35,227,376 L1399P probably damaging Het
Olfr111 G A 17: 37,530,664 R229H probably benign Het
Olfr1254 T A 2: 89,788,627 I242F possibly damaging Het
Olfr53 T C 7: 140,652,474 M165T probably benign Het
Olfr810 T C 10: 129,791,128 I154V probably benign Het
Olfr892-ps1 T C 9: 38,190,589 L288S unknown Het
Pcdhb4 A G 18: 37,309,296 D553G probably benign Het
Phip A G 9: 82,887,609 L1147P probably damaging Het
Phlpp1 A G 1: 106,392,976 D1567G probably benign Het
Pigz T C 16: 31,942,040 C20R probably damaging Het
Plpp1 A G 13: 112,867,468 K252R probably benign Het
Polr2a A T 11: 69,735,048 S1759T unknown Het
Rbm42 G T 7: 30,645,711 P212T unknown Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc9a3 A C 13: 74,166,027 Q818P probably benign Het
St3gal4 T C 9: 35,106,321 probably null Het
Stard3nl G T 13: 19,370,351 A151E probably damaging Het
Syt9 T A 7: 107,436,790 I338N probably benign Het
Ticrr A T 7: 79,684,264 probably null Het
Tlr4 T A 4: 66,839,476 Y169N probably damaging Het
Tnc A C 4: 63,976,469 I1560S possibly damaging Het
Usp7 C A 16: 8,697,907 D644Y probably benign Het
Utp20 A G 10: 88,782,715 I1141T possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,141,097 M503V probably benign Het
Zfp384 T C 6: 125,036,558 S530P unknown Het
Zfp600 T A 4: 146,196,612 C617S unknown Het
Zfp819 A G 7: 43,617,724 R544G probably damaging Het
Other mutations in Slc35e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Slc35e1 APN 8 72483758 utr 3 prime probably benign
IGL01399:Slc35e1 APN 8 72484690 missense probably damaging 1.00
IGL02663:Slc35e1 APN 8 72488209 missense probably damaging 1.00
IGL03349:Slc35e1 APN 8 72483852 missense probably damaging 0.99
R0009:Slc35e1 UTSW 8 72484709 missense probably damaging 1.00
R0009:Slc35e1 UTSW 8 72484709 missense probably damaging 1.00
R0054:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0105:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0401:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0510:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0511:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0529:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0566:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0968:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0969:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1029:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1051:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1123:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1245:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1247:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1314:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1343:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1357:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1401:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1430:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1715:Slc35e1 UTSW 8 72483977 missense probably benign 0.05
R3031:Slc35e1 UTSW 8 72484891 missense probably benign 0.03
R3769:Slc35e1 UTSW 8 72491870 missense possibly damaging 0.89
R4745:Slc35e1 UTSW 8 72492322 missense possibly damaging 0.81
R6884:Slc35e1 UTSW 8 72484882 missense possibly damaging 0.77
R7309:Slc35e1 UTSW 8 72492514 missense unknown
R7848:Slc35e1 UTSW 8 72492436 missense probably benign 0.08
R7913:Slc35e1 UTSW 8 72484662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATTCTGCTAGGCGCTC -3'
(R):5'- TGATTTTGAGCGCCTTCCCG -3'

Sequencing Primer
(F):5'- TTCTGCTAGGCGCTCGGTAAAC -3'
(R):5'- GTCGCTGTGCCACATCCTAG -3'
Posted On2020-06-30