Incidental Mutation 'R8080:St3gal4'
ID643753
Institutional Source Beutler Lab
Gene Symbol St3gal4
Ensembl Gene ENSMUSG00000032038
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 4
SynonymsST3Gal IV, Siat4c
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8080 (G1)
Quality Score85.0131
Status Validated
Chromosome9
Chromosomal Location35046576-35119268 bp(-) (GRCm38)
Type of Mutationsplice site (254 bp from exon)
DNA Base Change (assembly) T to C at 35106321 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034537] [ENSMUST00000213526] [ENSMUST00000215089] [ENSMUST00000216557]
Predicted Effect probably benign
Transcript: ENSMUST00000034537
SMART Domains Protein: ENSMUSP00000034537
Gene: ENSMUSG00000032038

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_29 70 332 4.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213526
Predicted Effect probably benign
Transcript: ENSMUST00000215089
Predicted Effect probably null
Transcript: ENSMUST00000216557
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 94.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a null allele show thrombocytopenia, altered platelet physiology, increased bleeding times, and abnormal leukocyte migration. Homozygotes for a different null allele fail to develop seizures in response to kindling, and show anxiety-like behaviors and altered sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,133,074 Q277R probably damaging Het
Anapc5 T C 5: 122,807,338 N226D probably damaging Het
Bcl2l11 T C 2: 128,128,666 C12R probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Brca2 A T 5: 150,539,892 E1040D probably benign Het
Cdca2 G A 14: 67,677,555 Q752* probably null Het
Cntn2 T C 1: 132,521,798 D635G probably damaging Het
Cntnap5b A T 1: 100,072,203 I229F probably benign Het
Ctr9 G A 7: 111,051,567 E900K possibly damaging Het
Dmbt1 A G 7: 131,088,770 Y911C unknown Het
Egflam T A 15: 7,398,080 D2V probably benign Het
Enpep A T 3: 129,299,134 N505K probably damaging Het
Fam13a A G 6: 58,956,805 S267P probably damaging Het
Fam172a T A 13: 78,006,446 L316Q probably damaging Het
Fancc G T 13: 63,403,023 T12K Het
Fbxo3 A G 2: 104,033,667 Y89C probably damaging Het
Garem2 A G 5: 30,108,387 Y83C probably damaging Het
Gm17079 T C 14: 51,693,023 T122A Het
Gm3696 A T 14: 7,089,870 L71* probably null Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gmip A T 8: 69,816,086 T454S possibly damaging Het
Helz2 T A 2: 181,238,262 T554S probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrc A G 7: 45,336,838 E471G probably damaging Het
Hydin A G 8: 110,535,231 I2655V probably benign Het
Ighv1-64 T C 12: 115,507,843 H18R probably benign Het
Jcad A G 18: 4,649,270 Y47C probably benign Het
Jmjd4 A G 11: 59,450,353 T37A probably benign Het
Kalrn C T 16: 33,975,668 G2915S possibly damaging Het
Kdm5d T C Y: 910,742 F285L probably benign Het
Lmna A G 3: 88,486,561 F237L probably damaging Het
Med12l A G 3: 59,265,186 K1788E probably damaging Het
Mrgprb1 T C 7: 48,446,910 probably null Het
Myh1 T A 11: 67,211,402 Y840N probably benign Het
Negr1 C A 3: 157,160,720 A302E probably damaging Het
Nup188 T C 2: 30,337,033 V1206A possibly damaging Het
Nup205 T C 6: 35,227,376 L1399P probably damaging Het
Olfr111 G A 17: 37,530,664 R229H probably benign Het
Olfr1254 T A 2: 89,788,627 I242F possibly damaging Het
Olfr53 T C 7: 140,652,474 M165T probably benign Het
Olfr810 T C 10: 129,791,128 I154V probably benign Het
Olfr892-ps1 T C 9: 38,190,589 L288S unknown Het
Pcdhb4 A G 18: 37,309,296 D553G probably benign Het
Phip A G 9: 82,887,609 L1147P probably damaging Het
Phlpp1 A G 1: 106,392,976 D1567G probably benign Het
Pigz T C 16: 31,942,040 C20R probably damaging Het
Plpp1 A G 13: 112,867,468 K252R probably benign Het
Polr2a A T 11: 69,735,048 S1759T unknown Het
Rbm42 G T 7: 30,645,711 P212T unknown Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc35e1 G A 8: 72,492,186 P134L probably damaging Het
Slc9a3 A C 13: 74,166,027 Q818P probably benign Het
Stard3nl G T 13: 19,370,351 A151E probably damaging Het
Syt9 T A 7: 107,436,790 I338N probably benign Het
Ticrr A T 7: 79,684,264 probably null Het
Tlr4 T A 4: 66,839,476 Y169N probably damaging Het
Tnc A C 4: 63,976,469 I1560S possibly damaging Het
Usp7 C A 16: 8,697,907 D644Y probably benign Het
Utp20 A G 10: 88,782,715 I1141T possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,141,097 M503V probably benign Het
Zfp384 T C 6: 125,036,558 S530P unknown Het
Zfp600 T A 4: 146,196,612 C617S unknown Het
Zfp819 A G 7: 43,617,724 R544G probably damaging Het
Other mutations in St3gal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:St3gal4 APN 9 35053069 unclassified probably benign
IGL01448:St3gal4 APN 9 35052331 missense probably benign 0.00
IGL01770:St3gal4 APN 9 35052305 missense possibly damaging 0.73
IGL02862:St3gal4 APN 9 35052247 missense probably benign 0.32
fuji UTSW 9 35053173 nonsense probably null
Granny_smith UTSW 9 35053262 missense probably damaging 1.00
Pomology UTSW 9 35053079 missense possibly damaging 0.67
R0362:St3gal4 UTSW 9 35053173 nonsense probably null
R0863:St3gal4 UTSW 9 35053448 missense probably damaging 1.00
R1457:St3gal4 UTSW 9 35054757 missense possibly damaging 0.66
R1530:St3gal4 UTSW 9 35052296 missense probably benign 0.00
R4991:St3gal4 UTSW 9 35053136 missense possibly damaging 0.93
R5452:St3gal4 UTSW 9 35053456 missense probably damaging 1.00
R6277:St3gal4 UTSW 9 35053262 missense probably damaging 1.00
R7564:St3gal4 UTSW 9 35052253 missense probably benign 0.09
R7725:St3gal4 UTSW 9 35053079 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TAGAGGAGCTAGTCAGACGC -3'
(R):5'- TATGTAGGAGGCCACTGTGCTG -3'

Sequencing Primer
(F):5'- CTAGTCAGACGCATGGGTG -3'
(R):5'- CCACTGTGCTGCTGTGTGC -3'
Posted On2020-08-12