Incidental Mutation 'R0102:Lrtm1'
ID63303
Institutional Source Beutler Lab
Gene Symbol Lrtm1
Ensembl Gene ENSMUSG00000045776
Gene Nameleucine-rich repeats and transmembrane domains 1
SynonymsA930016D02Rik
MMRRC Submission 038388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0102 (G1)
Quality Score126
Status Validated
Chromosome14
Chromosomal Location29018208-29033645 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 29022227 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567] [ENSMUST00000055662] [ENSMUST00000224708] [ENSMUST00000224760]
Predicted Effect probably benign
Transcript: ENSMUST00000022567
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055662
SMART Domains Protein: ENSMUSP00000061828
Gene: ENSMUSG00000045776

DomainStartEndE-ValueType
LRRNT 32 66 4.41e-6 SMART
LRR 65 84 2.33e2 SMART
LRR 85 108 2.67e-1 SMART
LRR 109 131 1.15e1 SMART
LRR_TYP 133 156 3.89e-3 SMART
LRRCT 192 245 8.63e-6 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224708
Predicted Effect probably benign
Transcript: ENSMUST00000224760
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.8%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,113 K1021R probably damaging Het
2610528J11Rik G A 4: 118,529,565 V36M probably damaging Het
4930402F06Rik T A 2: 35,375,783 R292* probably null Het
Abcb4 T C 5: 8,909,194 F207S probably damaging Het
Afap1l2 G T 19: 56,928,440 probably benign Het
Arfgef2 A T 2: 166,845,465 H203L probably benign Het
Cfi A C 3: 129,848,767 H90P probably damaging Het
Col1a2 T A 6: 4,520,775 S371T possibly damaging Het
Cyp2d10 C T 15: 82,404,593 M229I probably benign Het
Dnah5 A G 15: 28,245,751 probably benign Het
Dnttip2 G T 3: 122,275,803 M222I probably benign Het
Dync1li2 A T 8: 104,428,125 Y284N probably benign Het
Ebf1 T C 11: 44,991,455 Y413H probably benign Het
Exog A G 9: 119,452,253 T186A possibly damaging Het
Fam171a2 T C 11: 102,444,113 N66S possibly damaging Het
Gad1 G A 2: 70,587,239 probably null Het
Golgb1 C A 16: 36,875,468 probably benign Het
Gprc5a A T 6: 135,079,035 N160I probably damaging Het
Haus3 A G 5: 34,165,914 probably null Het
Klhl20 A T 1: 161,090,445 C90* probably null Het
Krt84 T A 15: 101,528,703 I342L probably damaging Het
Lifr G A 15: 7,178,892 D584N probably damaging Het
Lrp1b G A 2: 41,408,985 probably benign Het
Med25 C T 7: 44,885,480 V80I possibly damaging Het
Mest A G 6: 30,746,270 I279V probably damaging Het
Mki67 T C 7: 135,713,803 R81G probably benign Het
Naa25 A G 5: 121,435,569 D787G possibly damaging Het
Naaladl1 C T 19: 6,112,504 P465S probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Necab3 G A 2: 154,545,312 R302C probably damaging Het
Nsg1 A T 5: 38,158,910 D32E probably damaging Het
Nuggc A G 14: 65,613,551 D290G probably null Het
Nup205 A T 6: 35,225,780 probably benign Het
Olfr1100 A T 2: 86,978,205 I197N possibly damaging Het
Olfr1216 T C 2: 89,013,671 Y131C probably damaging Het
Olfr1250 T C 2: 89,656,655 N262S probably benign Het
Olfr1308 G C 2: 111,960,597 Q159E probably damaging Het
Olfr1361 T C 13: 21,658,735 D196G probably damaging Het
Olfr743 T A 14: 50,533,631 L73Q probably damaging Het
Otp T C 13: 94,877,155 V27A probably benign Het
Phip A T 9: 82,905,792 probably null Het
Pon2 A G 6: 5,289,091 probably benign Het
Ppp1r12b T A 1: 134,835,899 probably null Het
Ppp1r15b A G 1: 133,133,170 N475S probably damaging Het
Prrt3 A T 6: 113,497,829 L144H probably damaging Het
Psmb7 A G 2: 38,643,365 V50A possibly damaging Het
Sacs T A 14: 61,204,568 S1354R probably damaging Het
Sdcbp2 A G 2: 151,583,964 T29A probably benign Het
Shbg T A 11: 69,617,589 probably benign Het
Shcbp1 A G 8: 4,744,452 I447T probably damaging Het
Tbc1d9b T C 11: 50,135,849 V48A probably damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trappc12 A T 12: 28,746,752 F260L probably damaging Het
Trim10 C A 17: 36,870,182 H102N probably damaging Het
Ube2u A G 4: 100,549,925 T215A possibly damaging Het
Vcan T G 13: 89,703,668 T1058P probably benign Het
Other mutations in Lrtm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Lrtm1 APN 14 29021949 missense probably benign 0.00
R0102:Lrtm1 UTSW 14 29022227 splice site probably benign
R0602:Lrtm1 UTSW 14 29022222 splice site probably benign
R5214:Lrtm1 UTSW 14 29021694 missense possibly damaging 0.58
R5253:Lrtm1 UTSW 14 29021844 missense probably benign 0.13
R5787:Lrtm1 UTSW 14 29021990 missense possibly damaging 0.89
R5937:Lrtm1 UTSW 14 29021830 missense possibly damaging 0.90
R6238:Lrtm1 UTSW 14 29027671 missense probably benign 0.02
R6850:Lrtm1 UTSW 14 29027450 missense probably benign 0.00
R7304:Lrtm1 UTSW 14 29022118 missense probably damaging 0.97
R7363:Lrtm1 UTSW 14 29021893 missense probably damaging 1.00
R7385:Lrtm1 UTSW 14 29027716 missense probably benign 0.00
RF036:Lrtm1 UTSW 14 29021443 frame shift probably null
RF063:Lrtm1 UTSW 14 29021443 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGAAAGCAGCTTTGCCCATGCC -3'
(R):5'- TGCACACTGTGATGAGCATAACACC -3'

Sequencing Primer
(F):5'- GGGAGCTAGATCTTTCATCCAAC -3'
(R):5'- TGTGATGAGCATAACACCCAATG -3'
Posted On2013-07-30