Incidental Mutation 'R8223:Eml1'
ID636846
Institutional Source Beutler Lab
Gene Symbol Eml1
Ensembl Gene ENSMUSG00000058070
Gene Nameechinoderm microtubule associated protein like 1
SynonymsA930030P13Rik, ELP79, 1110008N23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R8223 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location108370957-108539617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 108536310 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 726 (F726V)
Ref Sequence ENSEMBL: ENSMUSP00000105486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054955] [ENSMUST00000109857] [ENSMUST00000109860] [ENSMUST00000130999]
Predicted Effect probably benign
Transcript: ENSMUST00000054955
AA Change: F695V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000057209
Gene: ENSMUSG00000058070
AA Change: F695V

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 119 146 N/A INTRINSIC
WD40 228 277 5.6e-3 SMART
WD40 280 325 2.21e1 SMART
WD40 328 367 4.46e-1 SMART
WD40 375 413 5.73e0 SMART
WD40 416 456 5.75e-1 SMART
WD40 496 539 4.24e-3 SMART
WD40 542 580 1.37e2 SMART
WD40 583 622 1.7e-2 SMART
WD40 629 668 1.58e-2 SMART
Blast:WD40 694 735 7e-20 BLAST
WD40 741 781 2.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109857
AA Change: F712V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105483
Gene: ENSMUSG00000058070
AA Change: F712V

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 119 146 N/A INTRINSIC
WD40 245 294 5.6e-3 SMART
WD40 297 342 2.21e1 SMART
WD40 345 384 4.46e-1 SMART
WD40 392 430 5.73e0 SMART
WD40 433 473 5.75e-1 SMART
WD40 513 556 4.24e-3 SMART
WD40 559 597 1.37e2 SMART
WD40 600 639 1.7e-2 SMART
WD40 646 685 1.58e-2 SMART
Blast:WD40 711 752 7e-20 BLAST
WD40 758 798 2.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109860
AA Change: F726V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105486
Gene: ENSMUSG00000058070
AA Change: F726V

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
coiled coil region 31 72 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 150 177 N/A INTRINSIC
Pfam:HELP 184 258 1.8e-35 PFAM
WD40 259 308 5.6e-3 SMART
WD40 311 356 2.21e1 SMART
WD40 359 398 4.46e-1 SMART
WD40 406 444 5.73e0 SMART
WD40 447 487 5.75e-1 SMART
WD40 527 570 4.24e-3 SMART
WD40 573 611 1.37e2 SMART
WD40 614 653 1.7e-2 SMART
WD40 660 699 1.58e-2 SMART
Blast:WD40 725 766 7e-20 BLAST
WD40 772 812 2.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130999
SMART Domains Protein: ENSMUSP00000118325
Gene: ENSMUSG00000058070

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
coiled coil region 31 72 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 150 177 N/A INTRINSIC
WD40 259 308 5.6e-3 SMART
WD40 311 356 2.21e1 SMART
WD40 359 398 4.46e-1 SMART
WD40 406 444 5.73e0 SMART
WD40 447 487 5.75e-1 SMART
WD40 527 570 4.24e-3 SMART
WD40 573 611 1.37e2 SMART
WD40 614 653 1.7e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human echinoderm microtubule-associated protein-like is a strong candidate for the Usher syndrome type 1A gene. Usher syndromes (USHs) are a group of genetic disorders consisting of congenital deafness, retinitis pigmentosa, and vestibular dysfunction of variable onset and severity depending on the genetic type. The disease process in USHs involves the entire brain and is not limited to the posterior fossa or auditory and visual systems. The USHs are catagorized as type I (USH1A, USH1B, USH1C, USH1D, USH1E and USH1F), type II (USH2A and USH2B) and type III (USH3). The type I is the most severe form. Gene loci responsible for these three types are all mapped. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit subcortical band heterotopia associated with seizures, developmental delay and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 T A 17: 57,361,692 W18R probably damaging Het
Alms1 T A 6: 85,643,240 Y2417* probably null Het
Apold1 T A 6: 134,984,185 S201T probably benign Het
Arhgap31 G A 16: 38,603,722 P661S probably benign Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Cacfd1 T C 2: 27,018,384 V110A possibly damaging Het
Capn2 A G 1: 182,482,534 probably null Het
Chadl T C 15: 81,695,134 E98G possibly damaging Het
Crxos T C 7: 15,897,469 Y31H probably benign Het
Cyp4f14 A C 17: 32,911,653 probably null Het
Cyp4f39 T C 17: 32,470,865 I95T probably benign Het
Dars T C 1: 128,372,224 E341G probably benign Het
Dchs1 G T 7: 105,762,617 R1431S possibly damaging Het
Dopey1 T A 9: 86,518,292 H1001Q probably damaging Het
Efemp1 T C 11: 28,854,528 Y19H probably benign Het
Fdx1 A T 9: 51,948,621 D136E probably benign Het
Ganab A T 19: 8,910,828 D446V probably damaging Het
Gusb A G 5: 129,990,112 V561A probably benign Het
Hcn1 A T 13: 117,873,870 D328V unknown Het
Hdgfl1 A G 13: 26,770,064 Y9H probably damaging Het
Hes3 T A 4: 152,287,115 S101C probably damaging Het
Igkv2-112 T C 6: 68,220,595 S84P probably benign Het
Ints9 C T 14: 65,020,360 P330S possibly damaging Het
Kdm7a A T 6: 39,149,301 N583K probably damaging Het
Klhl10 C T 11: 100,447,401 T322M probably damaging Het
Kmt2c A T 5: 25,324,218 V1545D possibly damaging Het
Laptm5 T C 4: 130,926,200 probably null Het
Ldlr A G 9: 21,747,250 T833A probably damaging Het
Llgl1 G T 11: 60,702,822 L40F possibly damaging Het
Lrrc14 T C 15: 76,714,556 L464S probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Lysmd3 T A 13: 81,669,267 L121H Het
Map2 T C 1: 66,425,490 S1680P probably damaging Het
Med12l T C 3: 59,086,363 V583A possibly damaging Het
Mfsd4b5 A G 10: 39,970,250 Y445H probably damaging Het
Morf4l1 G A 9: 90,097,422 P169S probably benign Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Ola1 A G 2: 73,099,350 L303P probably damaging Het
Olfr1501 G T 19: 13,838,861 T104K probably damaging Het
Olfr348 T A 2: 36,787,397 Y291N Het
Olfr857 T C 9: 19,713,409 I194T probably benign Het
Olfr97 T C 17: 37,231,836 D178G possibly damaging Het
Pdlim3 A T 8: 45,900,525 H99L possibly damaging Het
Plagl2 G T 2: 153,231,541 T480N probably benign Het
Ptprq C T 10: 107,699,638 R422Q probably benign Het
Rad18 T A 6: 112,688,021 R51* probably null Het
Rpap3 T A 15: 97,691,304 T250S probably benign Het
Serpinb11 T C 1: 107,377,532 Y213H probably benign Het
Slc15a4 A G 5: 127,609,016 F201L possibly damaging Het
Slc25a4 A G 8: 46,210,859 S22P probably damaging Het
Slfn1 T A 11: 83,121,419 N120K probably damaging Het
Smok3c T C 5: 138,065,393 S381P probably benign Het
Sry T A Y: 2,663,204 Q152L unknown Het
Taar2 T A 10: 23,941,350 W263R probably damaging Het
Thnsl1 T A 2: 21,212,113 V226E probably benign Het
Tmeff2 T C 1: 51,133,120 probably null Het
Tox A G 4: 6,842,408 Y41H probably damaging Het
Trank1 T A 9: 111,365,889 Y994N probably damaging Het
Trim9 C T 12: 70,251,015 A713T probably damaging Het
Tub T A 7: 109,029,326 M393K probably benign Het
Ube4a A G 9: 44,960,035 L22P possibly damaging Het
Usp47 A G 7: 112,104,376 K1165R probably damaging Het
Usp6nl T A 2: 6,430,516 I362K probably damaging Het
Vmn1r217 T C 13: 23,114,199 I178V probably benign Het
Vmn1r45 T A 6: 89,933,092 T299S probably damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Xkr8 G A 4: 132,730,935 P144L probably damaging Het
Zfpm2 T C 15: 40,752,959 I35T probably benign Het
Other mutations in Eml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Eml1 APN 12 108514515 splice site probably null
IGL00774:Eml1 APN 12 108514515 splice site probably null
IGL01358:Eml1 APN 12 108514468 missense probably benign 0.05
IGL02316:Eml1 APN 12 108534759 intron probably benign
IGL02346:Eml1 APN 12 108537441 missense possibly damaging 0.87
IGL02480:Eml1 APN 12 108521696 missense probably benign 0.32
IGL02513:Eml1 APN 12 108530312 missense probably damaging 1.00
IGL02556:Eml1 APN 12 108537366 missense probably benign 0.00
IGL02565:Eml1 APN 12 108506520 missense probably damaging 1.00
IGL03217:Eml1 APN 12 108534942 missense probably benign 0.31
bubble UTSW 12 108513071 critical splice donor site probably null
R0027:Eml1 UTSW 12 108536298 missense possibly damaging 0.90
R0067:Eml1 UTSW 12 108463527 missense possibly damaging 0.61
R0124:Eml1 UTSW 12 108506608 missense probably benign 0.00
R0124:Eml1 UTSW 12 108509178 missense probably damaging 1.00
R0730:Eml1 UTSW 12 108530326 missense possibly damaging 0.79
R1566:Eml1 UTSW 12 108471892 missense probably damaging 0.99
R1883:Eml1 UTSW 12 108463652 missense probably damaging 0.97
R1927:Eml1 UTSW 12 108538217 nonsense probably null
R1938:Eml1 UTSW 12 108521396 missense possibly damaging 0.75
R2070:Eml1 UTSW 12 108512999 missense probably damaging 1.00
R2311:Eml1 UTSW 12 108537416 missense probably damaging 0.99
R2417:Eml1 UTSW 12 108536275 missense probably benign 0.00
R3120:Eml1 UTSW 12 108513053 missense probably benign 0.31
R4352:Eml1 UTSW 12 108534837 intron probably benign
R4471:Eml1 UTSW 12 108506635 intron probably benign
R4655:Eml1 UTSW 12 108534713 missense probably damaging 1.00
R5077:Eml1 UTSW 12 108506612 splice site probably benign
R5094:Eml1 UTSW 12 108536311 missense probably benign 0.11
R5113:Eml1 UTSW 12 108537337 missense possibly damaging 0.74
R5524:Eml1 UTSW 12 108521376 missense probably damaging 0.99
R5775:Eml1 UTSW 12 108506554 missense probably damaging 1.00
R6120:Eml1 UTSW 12 108527724 missense probably damaging 1.00
R6224:Eml1 UTSW 12 108514508 missense probably damaging 1.00
R6491:Eml1 UTSW 12 108513071 critical splice donor site probably null
R7035:Eml1 UTSW 12 108509234 missense probably damaging 1.00
R7134:Eml1 UTSW 12 108506551 missense probably benign 0.00
R7273:Eml1 UTSW 12 108538173 missense possibly damaging 0.87
R7606:Eml1 UTSW 12 108537366 missense probably benign 0.45
R7744:Eml1 UTSW 12 108516604 missense probably benign
R7820:Eml1 UTSW 12 108515174 missense possibly damaging 0.81
R8013:Eml1 UTSW 12 108521679 missense probably benign 0.18
R8258:Eml1 UTSW 12 108510199 missense probably damaging 0.97
R8259:Eml1 UTSW 12 108510199 missense probably damaging 0.97
R8399:Eml1 UTSW 12 108538131 missense possibly damaging 0.91
R8427:Eml1 UTSW 12 108530321 missense probably damaging 0.99
Z1088:Eml1 UTSW 12 108537459 missense possibly damaging 0.80
Z1177:Eml1 UTSW 12 108423139 start gained probably benign
Z1177:Eml1 UTSW 12 108534656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTTCCCTGTGGCTCTGAG -3'
(R):5'- GATTGTGAATCATGGCCCCAGG -3'

Sequencing Primer
(F):5'- TGAGGACTCTGCCTGACTC -3'
(R):5'- CAACTATGGGTAACTCTAGTGCCAG -3'
Posted On2020-07-13