Mutagenetix > Incidental Mutation

Incidental Mutation 'R7035:Eml1'

546626

Institutional Source

Beutler Lab

Gene Symbol

Eml1

Ensembl Gene

ENSMUSG00000058070

Gene Name

echinoderm microtubule associated protein like 1

Synonyms

A930030P13Rik, ELP79, 1110008N23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.134) question?

Stock #

R7035 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108370957-108539617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 108509234 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 275 (C275S)

Ref Sequence

ENSEMBL: ENSMUSP00000105486 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054955] [ENSMUST00000109857] [ENSMUST00000109860] [ENSMUST00000130999]

AlphaFold

Q05BC3

Predicted Effect

probably damaging
Transcript: ENSMUST00000054955
AA Change: C244S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057209
Gene: ENSMUSG00000058070
AA Change: C244S

Domain	Start	End	E-Value	Type
coiled coil region	1	41	N/A	INTRINSIC
low complexity region	72	84	N/A	INTRINSIC
low complexity region	119	146	N/A	INTRINSIC
WD40	228	277	5.6e-3	SMART
WD40	280	325	2.21e1	SMART
WD40	328	367	4.46e-1	SMART
WD40	375	413	5.73e0	SMART
WD40	416	456	5.75e-1	SMART
WD40	496	539	4.24e-3	SMART
WD40	542	580	1.37e2	SMART
WD40	583	622	1.7e-2	SMART
WD40	629	668	1.58e-2	SMART
Blast:WD40	694	735	7e-20	BLAST
WD40	741	781	2.96e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109857
AA Change: C261S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000105483
Gene: ENSMUSG00000058070
AA Change: C261S

Domain	Start	End	E-Value	Type
coiled coil region	1	41	N/A	INTRINSIC
low complexity region	72	84	N/A	INTRINSIC
low complexity region	119	146	N/A	INTRINSIC
WD40	245	294	5.6e-3	SMART
WD40	297	342	2.21e1	SMART
WD40	345	384	4.46e-1	SMART
WD40	392	430	5.73e0	SMART
WD40	433	473	5.75e-1	SMART
WD40	513	556	4.24e-3	SMART
WD40	559	597	1.37e2	SMART
WD40	600	639	1.7e-2	SMART
WD40	646	685	1.58e-2	SMART
Blast:WD40	711	752	7e-20	BLAST
WD40	758	798	2.96e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109860
AA Change: C275S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105486
Gene: ENSMUSG00000058070
AA Change: C275S

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
coiled coil region	31	72	N/A	INTRINSIC
low complexity region	103	115	N/A	INTRINSIC
low complexity region	150	177	N/A	INTRINSIC
Pfam:HELP	184	258	1.8e-35	PFAM
WD40	259	308	5.6e-3	SMART
WD40	311	356	2.21e1	SMART
WD40	359	398	4.46e-1	SMART
WD40	406	444	5.73e0	SMART
WD40	447	487	5.75e-1	SMART
WD40	527	570	4.24e-3	SMART
WD40	573	611	1.37e2	SMART
WD40	614	653	1.7e-2	SMART
WD40	660	699	1.58e-2	SMART
Blast:WD40	725	766	7e-20	BLAST
WD40	772	812	2.96e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000130999
AA Change: C275S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000118325
Gene: ENSMUSG00000058070
AA Change: C275S

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
coiled coil region	31	72	N/A	INTRINSIC
low complexity region	103	115	N/A	INTRINSIC
low complexity region	150	177	N/A	INTRINSIC
WD40	259	308	5.6e-3	SMART
WD40	311	356	2.21e1	SMART
WD40	359	398	4.46e-1	SMART
WD40	406	444	5.73e0	SMART
WD40	447	487	5.75e-1	SMART
WD40	527	570	4.24e-3	SMART
WD40	573	611	1.37e2	SMART
WD40	614	653	1.7e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human echinoderm microtubule-associated protein-like is a strong candidate for the Usher syndrome type 1A gene. Usher syndromes (USHs) are a group of genetic disorders consisting of congenital deafness, retinitis pigmentosa, and vestibular dysfunction of variable onset and severity depending on the genetic type. The disease process in USHs involves the entire brain and is not limited to the posterior fossa or auditory and visual systems. The USHs are catagorized as type I (USH1A, USH1B, USH1C, USH1D, USH1E and USH1F), type II (USH2A and USH2B) and type III (USH3). The type I is the most severe form. Gene loci responsible for these three types are all mapped. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit subcortical band heterotopia associated with seizures, developmental delay and behavioral deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032F04Rik	T	A	3: 68,869,939	F78I	probably benign	Het
1700102P08Rik	A	T	9: 108,395,311	D140V	possibly damaging	Het
3632451O06Rik	T	A	14: 49,773,050	H400L	possibly damaging	Het
6430548M08Rik	A	T	8: 120,152,486	S208C	probably damaging	Het
Abcd4	G	T	12: 84,615,349	T41K	probably damaging	Het
Acaca	C	T	11: 84,238,943	R375C	probably damaging	Het
Acad11	T	A	9: 104,113,495	V433D	probably damaging	Het
Adal	T	A	2: 121,155,461	C226S	probably benign	Het
Aldh3b2	A	T	19: 3,978,142	M95L	probably benign	Het
Ano4	A	G	10: 88,954,711	F842S	probably damaging	Het
Ap5s1	T	C	2: 131,212,812	F181S	probably damaging	Het
Apba1	G	A	19: 23,917,567	D456N	possibly damaging	Het
Atp6v0a1	A	C	11: 101,027,357	Q199H	probably damaging	Het
Atp8a1	C	G	5: 67,781,030	G161A	probably benign	Het
Atxn2	C	T	5: 121,811,467	Q61*	probably null	Het
BC051142	C	T	17: 34,460,331		probably benign	Het
Cacna2d1	T	A	5: 16,246,672	I178K	probably damaging	Het
Catsperb	A	C	12: 101,415,334	T92P	probably damaging	Het
Ccdc175	A	G	12: 72,155,645	I292T	probably benign	Het
Cep290	T	A	10: 100,499,071	S318T	probably benign	Het
Cfb	T	A	17: 34,860,031	Y826F	possibly damaging	Het
Cntn1	C	A	15: 92,314,511	D851E	probably benign	Het
Coq6	A	G	12: 84,368,641	D146G	probably damaging	Het
Crem	G	A	18: 3,327,503	T12I	probably damaging	Het
Dennd4c	G	A	4: 86,812,337	V824I	probably damaging	Het
Dnase2b	C	T	3: 146,582,341	C333Y	probably damaging	Het
Dopey1	T	A	9: 86,524,302	F365I	possibly damaging	Het
Dysf	A	T	6: 84,186,392	I1570F	probably benign	Het
E330021D16Rik	G	A	6: 136,401,349	T161M	possibly damaging	Het
Fam135b	A	C	15: 71,462,253	S1031A	possibly damaging	Het
Gga2	T	C	7: 121,989,716	D596G	probably damaging	Het
Gin1	A	C	1: 97,792,375	Y365S	possibly damaging	Het
Gipr	T	A	7: 19,162,884	I154F	probably damaging	Het
Gm5478	A	T	15: 101,645,197	I284N	possibly damaging	Het
Gnat1	A	T	9: 107,676,628		probably benign	Het
Gsdmc	A	T	15: 63,778,720		probably null	Het
Lama1	T	A	17: 67,781,049	I1554N		Het
Mycbp2	T	A	14: 103,174,981	T2519S	probably benign	Het
Mylk	G	A	16: 34,976,982	V1604M	possibly damaging	Het
Mypop	C	T	7: 18,991,997		probably benign	Het
Nol6	A	T	4: 41,118,479	V774E	probably benign	Het
Nol8	T	C	13: 49,661,202	V262A	probably benign	Het
Npepps	A	T	11: 97,223,139	V637D	probably damaging	Het
Olfr1	T	C	11: 73,395,718	I101M	probably benign	Het
Olfr1275	A	G	2: 111,231,439	M118T	probably damaging	Het
Olfr472	T	C	7: 107,902,933	V72A	probably benign	Het
Pcdhgb8	A	T	18: 37,763,148	I424F	possibly damaging	Het
Phf7	A	C	14: 31,239,226	W231G	probably damaging	Het
Plagl1	A	G	10: 13,128,233		probably benign	Het
Plat	A	T	8: 22,772,311	D117V	probably benign	Het
Prkag2	T	C	5: 24,947,566	Y180C	probably damaging	Het
Prpf8	T	C	11: 75,504,828	I1927T	possibly damaging	Het
Ptchd1	T	A	X: 155,574,712	Y499F	probably damaging	Het
Rad17	T	A	13: 100,627,625	D446V	possibly damaging	Het
Ralgapa2	G	T	2: 146,511,857	Q15K	probably damaging	Het
Ret	A	G	6: 118,163,286	Y982H	probably damaging	Het
Rnf145	T	A	11: 44,561,756	S521T	probably damaging	Het
Samd4	G	A	14: 47,089,163		silent	Het
Sardh	T	C	2: 27,230,842	D390G	probably damaging	Het
Saxo1	T	C	4: 86,445,122	T375A	probably damaging	Het
Scly	A	G	1: 91,308,403	T126A	probably damaging	Het
Slc6a16	T	A	7: 45,260,827	V307D	probably damaging	Het
Sned1	T	C	1: 93,262,130	C320R	probably damaging	Het
Sspo	G	A	6: 48,449,213		probably null	Het
Sycp2l	C	T	13: 41,157,497	T645I	unknown	Het
Tpmt	T	C	13: 47,040,108	K72E	probably damaging	Het
Vmn1r51	A	T	6: 90,129,225	H41L	probably benign	Het
Wdfy3	A	T	5: 101,855,549	I2900N	probably damaging	Het
Zfp663	A	G	2: 165,353,103	S399P	probably benign	Het
Zfp692	T	C	11: 58,309,442		probably null	Het

Other mutations in Eml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00770:Eml1	APN	12	108514515	splice site	probably null
IGL00774:Eml1	APN	12	108514515	splice site	probably null
IGL01358:Eml1	APN	12	108514468	missense	probably benign	0.05
IGL02316:Eml1	APN	12	108534759	intron	probably benign
IGL02346:Eml1	APN	12	108537441	missense	possibly damaging	0.87
IGL02480:Eml1	APN	12	108521696	missense	probably benign	0.32
IGL02513:Eml1	APN	12	108530312	missense	probably damaging	1.00
IGL02556:Eml1	APN	12	108537366	missense	probably benign	0.00
IGL02565:Eml1	APN	12	108506520	missense	probably damaging	1.00
IGL03217:Eml1	APN	12	108534942	missense	probably benign	0.31
bubble	UTSW	12	108513071	critical splice donor site	probably null
R0027:Eml1	UTSW	12	108536298	missense	possibly damaging	0.90
R0067:Eml1	UTSW	12	108463527	missense	possibly damaging	0.61
R0124:Eml1	UTSW	12	108506608	missense	probably benign	0.00
R0124:Eml1	UTSW	12	108509178	missense	probably damaging	1.00
R0730:Eml1	UTSW	12	108530326	missense	possibly damaging	0.79
R1566:Eml1	UTSW	12	108471892	missense	probably damaging	0.99
R1883:Eml1	UTSW	12	108463652	missense	probably damaging	0.97
R1927:Eml1	UTSW	12	108538217	nonsense	probably null
R1938:Eml1	UTSW	12	108521396	missense	possibly damaging	0.75
R2070:Eml1	UTSW	12	108512999	missense	probably damaging	1.00
R2311:Eml1	UTSW	12	108537416	missense	probably damaging	0.99
R2417:Eml1	UTSW	12	108536275	missense	probably benign	0.00
R3120:Eml1	UTSW	12	108513053	missense	probably benign	0.31
R4352:Eml1	UTSW	12	108534837	intron	probably benign
R4471:Eml1	UTSW	12	108506635	intron	probably benign
R4655:Eml1	UTSW	12	108534713	missense	probably damaging	1.00
R5077:Eml1	UTSW	12	108506612	splice site	probably benign
R5094:Eml1	UTSW	12	108536311	missense	probably benign	0.11
R5113:Eml1	UTSW	12	108537337	missense	possibly damaging	0.74
R5524:Eml1	UTSW	12	108521376	missense	probably damaging	0.99
R5775:Eml1	UTSW	12	108506554	missense	probably damaging	1.00
R6120:Eml1	UTSW	12	108527724	missense	probably damaging	1.00
R6224:Eml1	UTSW	12	108514508	missense	probably damaging	1.00
R6491:Eml1	UTSW	12	108513071	critical splice donor site	probably null
R7134:Eml1	UTSW	12	108506551	missense	probably benign	0.00
R7273:Eml1	UTSW	12	108538173	missense	possibly damaging	0.87
R7606:Eml1	UTSW	12	108537366	missense	probably benign	0.45
R7744:Eml1	UTSW	12	108516604	missense	probably benign
R7820:Eml1	UTSW	12	108515174	missense	possibly damaging	0.81
R8013:Eml1	UTSW	12	108521679	missense	probably benign	0.18
R8223:Eml1	UTSW	12	108536310	missense	probably benign	0.00
R8258:Eml1	UTSW	12	108510199	missense	probably damaging	0.97
R8259:Eml1	UTSW	12	108510199	missense	probably damaging	0.97
R8399:Eml1	UTSW	12	108538131	missense	possibly damaging	0.91
R8427:Eml1	UTSW	12	108530321	missense	probably damaging	0.99
R9002:Eml1	UTSW	12	108538179	missense	probably damaging	1.00
R9220:Eml1	UTSW	12	108514443	nonsense	probably null
R9432:Eml1	UTSW	12	108516583	missense	probably benign	0.00
R9446:Eml1	UTSW	12	108515206	missense	probably damaging	0.98
R9500:Eml1	UTSW	12	108527699	missense	probably damaging	1.00
Z1088:Eml1	UTSW	12	108537459	missense	possibly damaging	0.80
Z1177:Eml1	UTSW	12	108423139	start gained	probably benign
Z1177:Eml1	UTSW	12	108534656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGTTGAATGAAGCGGTAGTTC -3'
(R):5'- TCTGGTCACATAGAAGCACAG -3'

Sequencing Primer
(F):5'- AATGAAGCGGTAGTTCTCCAGCTC -3'
(R):5'- TCACATAGAAGCACAGAGAGC -3'

Posted On

2019-05-13