Incidental Mutation 'R8234:Triml1'
ID637267
Institutional Source Beutler Lab
Gene Symbol Triml1
Ensembl Gene ENSMUSG00000031651
Gene Nametripartite motif family-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R8234 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location43129807-43141486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43141248 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 49 (S49G)
Ref Sequence ENSEMBL: ENSMUSP00000050267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059692]
Predicted Effect probably benign
Transcript: ENSMUST00000059692
AA Change: S49G

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000050267
Gene: ENSMUSG00000031651
AA Change: S49G

DomainStartEndE-ValueType
RING 22 62 1.14e-8 SMART
coiled coil region 196 235 N/A INTRINSIC
PRY 291 343 4.64e-23 SMART
Pfam:SPRY 346 462 6.6e-14 PFAM
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tripartite motif family protein with similarities to E3 ubiquitin-protein ligases. While the function of the encoded protein has not been determined, the orthologous protein in mouse has been shown to bind ubiquitin-specific protease 5 and is involved in the blastocyst development stage. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,753,510 S1180P possibly damaging Het
Abhd4 T A 14: 54,261,676 M38K probably benign Het
Ackr1 T A 1: 173,332,015 R312S probably benign Het
Agpat9 T C 5: 100,857,210 probably null Het
Akap9 T C 5: 4,044,845 V2213A probably benign Het
Alox5 T A 6: 116,413,874 R439W probably damaging Het
Atrn A T 2: 131,023,000 probably null Het
Casd1 A G 6: 4,601,209 N14S probably damaging Het
Cry2 T C 2: 92,412,629 S542G probably benign Het
Cyb5rl A G 4: 107,068,738 Y39C probably damaging Het
Dmpk A T 7: 19,088,123 K335N probably benign Het
Dnaic1 A G 4: 41,625,221 D395G probably benign Het
Dock4 C T 12: 40,834,838 probably null Het
Fmo4 T C 1: 162,805,188 D198G probably damaging Het
Foxc2 G A 8: 121,118,038 R475Q probably damaging Het
Gipr C A 7: 19,164,608 G37V unknown Het
Gm15800 T A 5: 121,339,544 N2843K possibly damaging Het
Gm2046 A T 12: 87,973,738 I71L noncoding transcript Het
Hcn4 A G 9: 58,844,150 D353G unknown Het
Hmcn1 C T 1: 150,594,010 V4973M possibly damaging Het
Il20rb C T 9: 100,459,210 S281N probably benign Het
Kcnh4 A T 11: 100,752,267 N391K possibly damaging Het
Kitl A G 10: 100,051,846 T6A probably damaging Het
Krt36 A G 11: 100,104,201 Y182H probably damaging Het
Lrp1b T G 2: 41,312,656 I1262L Het
Mtf1 A G 4: 124,844,246 E644G probably benign Het
Mtx2 A G 2: 74,869,362 Y159C probably damaging Het
Nags C T 11: 102,148,998 S504F probably damaging Het
Ncam1 A T 9: 49,545,223 F475L probably damaging Het
Nipal2 G T 15: 34,600,032 T213N possibly damaging Het
Olfr1098 A G 2: 86,922,969 S188P probably damaging Het
Olfr554 T A 7: 102,640,471 L75Q probably damaging Het
Pkm T C 9: 59,670,599 V233A possibly damaging Het
Pros1 T A 16: 62,928,177 I671N possibly damaging Het
Rasd1 T C 11: 59,964,292 I121V probably damaging Het
Samhd1 A G 2: 157,116,350 probably null Het
Serpinb9f A T 13: 33,325,915 Y30F probably benign Het
Slc5a10 T C 11: 61,673,281 I543V probably benign Het
Stat5a A G 11: 100,879,303 I469V possibly damaging Het
Sugct T C 13: 16,857,874 E431G probably benign Het
Tecr C A 8: 83,573,251 R133L possibly damaging Het
Tiparp A G 3: 65,531,581 N106S probably benign Het
Trpm3 T A 19: 22,715,276 S244T possibly damaging Het
Ttn T C 2: 76,722,980 D31055G probably damaging Het
Vcp A T 4: 42,985,242 I369N probably damaging Het
Vmn2r110 A C 17: 20,584,429 N76K probably benign Het
Vmn2r12 T C 5: 109,086,208 T713A probably benign Het
Vmn2r17 A T 5: 109,453,369 K844N probably benign Het
Other mutations in Triml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Triml1 APN 8 43140961 splice site probably benign
IGL00920:Triml1 APN 8 43138682 missense probably damaging 1.00
IGL01319:Triml1 APN 8 43141397 utr 5 prime probably benign
IGL01323:Triml1 APN 8 43138563 splice site probably null
IGL01998:Triml1 APN 8 43141313 missense probably damaging 1.00
IGL02394:Triml1 APN 8 43138592 missense possibly damaging 0.57
R0359:Triml1 UTSW 8 43130505 missense probably damaging 1.00
R0400:Triml1 UTSW 8 43141040 missense probably benign 0.03
R1799:Triml1 UTSW 8 43130475 missense probably damaging 1.00
R2008:Triml1 UTSW 8 43130605 missense probably damaging 0.97
R2363:Triml1 UTSW 8 43141371 missense probably damaging 0.99
R2405:Triml1 UTSW 8 43130283 missense probably damaging 1.00
R5333:Triml1 UTSW 8 43130290 missense possibly damaging 0.82
R6093:Triml1 UTSW 8 43140718 missense probably benign 0.04
R6244:Triml1 UTSW 8 43138756 nonsense probably null
R6808:Triml1 UTSW 8 43141221 missense probably damaging 0.99
R6860:Triml1 UTSW 8 43130566 missense probably damaging 1.00
R7231:Triml1 UTSW 8 43136371 missense probably benign
R7826:Triml1 UTSW 8 43138766 missense possibly damaging 0.95
R8054:Triml1 UTSW 8 43130383 missense probably damaging 0.99
R8100:Triml1 UTSW 8 43138680 missense probably benign
Z1088:Triml1 UTSW 8 43130398 missense probably damaging 1.00
Z1177:Triml1 UTSW 8 43140705 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TCCCTTGACTTGGAGGTGAG -3'
(R):5'- ACCAGAAGTGTAGCCTTGTC -3'

Sequencing Primer
(F):5'- GGTGAGACATTAATGACACTCTGCTC -3'
(R):5'- GTCCTGATGTCCAACCATGAG -3'
Posted On2020-07-13