Incidental Mutation 'R8234:Tiparp'
ID637253
Institutional Source Beutler Lab
Gene Symbol Tiparp
Ensembl Gene ENSMUSG00000034640
Gene NameTCDD-inducible poly(ADP-ribose) polymerase
SynonymsPARP7, PARP-7, DDF1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock #R8234 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location65528410-65555518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65531581 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 106 (N106S)
Ref Sequence ENSEMBL: ENSMUSP00000048051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047906] [ENSMUST00000130705]
Predicted Effect probably benign
Transcript: ENSMUST00000047906
AA Change: N106S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048051
Gene: ENSMUSG00000034640
AA Change: N106S

DomainStartEndE-ValueType
Blast:ZnF_C3H1 238 264 2e-8 BLAST
Pfam:PARP 463 650 2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130705
SMART Domains Protein: ENSMUSP00000119951
Gene: ENSMUSG00000034640

DomainStartEndE-ValueType
Blast:ZnF_C3H1 56 82 3e-9 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase superfamily. Studies of the mouse ortholog have shown that the encoded protein catalyzes histone poly(ADP-ribosyl)ation and may be involved in T-cell function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality, skeletal and craniofacial defects, kidney defects and embryonic hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,753,510 S1180P possibly damaging Het
Abhd4 T A 14: 54,261,676 M38K probably benign Het
Ackr1 T A 1: 173,332,015 R312S probably benign Het
Agpat9 T C 5: 100,857,210 probably null Het
Akap9 T C 5: 4,044,845 V2213A probably benign Het
Alox5 T A 6: 116,413,874 R439W probably damaging Het
Atrn A T 2: 131,023,000 probably null Het
Casd1 A G 6: 4,601,209 N14S probably damaging Het
Cry2 T C 2: 92,412,629 S542G probably benign Het
Cyb5rl A G 4: 107,068,738 Y39C probably damaging Het
Dmpk A T 7: 19,088,123 K335N probably benign Het
Dnaic1 A G 4: 41,625,221 D395G probably benign Het
Dock4 C T 12: 40,834,838 probably null Het
Fmo4 T C 1: 162,805,188 D198G probably damaging Het
Foxc2 G A 8: 121,118,038 R475Q probably damaging Het
Gipr C A 7: 19,164,608 G37V unknown Het
Gm15800 T A 5: 121,339,544 N2843K possibly damaging Het
Gm2046 A T 12: 87,973,738 I71L noncoding transcript Het
Hcn4 A G 9: 58,844,150 D353G unknown Het
Hmcn1 C T 1: 150,594,010 V4973M possibly damaging Het
Il20rb C T 9: 100,459,210 S281N probably benign Het
Kcnh4 A T 11: 100,752,267 N391K possibly damaging Het
Kitl A G 10: 100,051,846 T6A probably damaging Het
Krt36 A G 11: 100,104,201 Y182H probably damaging Het
Lrp1b T G 2: 41,312,656 I1262L Het
Mtf1 A G 4: 124,844,246 E644G probably benign Het
Mtx2 A G 2: 74,869,362 Y159C probably damaging Het
Nags C T 11: 102,148,998 S504F probably damaging Het
Ncam1 A T 9: 49,545,223 F475L probably damaging Het
Nipal2 G T 15: 34,600,032 T213N possibly damaging Het
Olfr1098 A G 2: 86,922,969 S188P probably damaging Het
Olfr554 T A 7: 102,640,471 L75Q probably damaging Het
Pkm T C 9: 59,670,599 V233A possibly damaging Het
Pros1 T A 16: 62,928,177 I671N possibly damaging Het
Rasd1 T C 11: 59,964,292 I121V probably damaging Het
Samhd1 A G 2: 157,116,350 probably null Het
Serpinb9f A T 13: 33,325,915 Y30F probably benign Het
Slc5a10 T C 11: 61,673,281 I543V probably benign Het
Stat5a A G 11: 100,879,303 I469V possibly damaging Het
Sugct T C 13: 16,857,874 E431G probably benign Het
Tecr C A 8: 83,573,251 R133L possibly damaging Het
Triml1 T C 8: 43,141,248 S49G probably benign Het
Trpm3 T A 19: 22,715,276 S244T possibly damaging Het
Ttn T C 2: 76,722,980 D31055G probably damaging Het
Vcp A T 4: 42,985,242 I369N probably damaging Het
Vmn2r110 A C 17: 20,584,429 N76K probably benign Het
Vmn2r12 T C 5: 109,086,208 T713A probably benign Het
Vmn2r17 A T 5: 109,453,369 K844N probably benign Het
Other mutations in Tiparp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Tiparp APN 3 65532109 missense probably damaging 1.00
IGL01448:Tiparp APN 3 65552609 nonsense probably null
IGL01452:Tiparp APN 3 65552609 nonsense probably null
IGL01454:Tiparp APN 3 65552609 nonsense probably null
IGL01456:Tiparp APN 3 65552609 nonsense probably null
IGL01463:Tiparp APN 3 65552609 nonsense probably null
IGL01467:Tiparp APN 3 65552609 nonsense probably null
IGL01468:Tiparp APN 3 65552609 nonsense probably null
IGL01470:Tiparp APN 3 65552609 nonsense probably null
IGL01476:Tiparp APN 3 65552609 nonsense probably null
IGL01481:Tiparp APN 3 65552609 nonsense probably null
IGL01590:Tiparp APN 3 65531976 missense probably benign 0.14
IGL01684:Tiparp APN 3 65553333 missense probably damaging 0.99
IGL02322:Tiparp APN 3 65532020 nonsense probably null
IGL02572:Tiparp APN 3 65531889 missense probably benign 0.01
BB003:Tiparp UTSW 3 65553525 missense possibly damaging 0.61
BB013:Tiparp UTSW 3 65553525 missense possibly damaging 0.61
R0401:Tiparp UTSW 3 65531436 missense probably benign 0.06
R0674:Tiparp UTSW 3 65553165 missense probably benign 0.03
R1316:Tiparp UTSW 3 65553351 missense probably damaging 1.00
R1766:Tiparp UTSW 3 65532049 missense probably damaging 1.00
R2140:Tiparp UTSW 3 65529252 intron probably benign
R2568:Tiparp UTSW 3 65553130 nonsense probably null
R4533:Tiparp UTSW 3 65546347 missense probably benign 0.05
R4751:Tiparp UTSW 3 65552804 missense probably damaging 1.00
R4812:Tiparp UTSW 3 65552769 missense possibly damaging 0.94
R5268:Tiparp UTSW 3 65547565 missense possibly damaging 0.72
R5622:Tiparp UTSW 3 65547525 missense probably benign 0.00
R5693:Tiparp UTSW 3 65553492 missense possibly damaging 0.89
R5765:Tiparp UTSW 3 65531350 missense possibly damaging 0.69
R6061:Tiparp UTSW 3 65553243 missense probably damaging 0.98
R6875:Tiparp UTSW 3 65531642 missense probably benign 0.01
R7123:Tiparp UTSW 3 65553527 missense probably damaging 1.00
R7926:Tiparp UTSW 3 65553525 missense possibly damaging 0.61
R8023:Tiparp UTSW 3 65531803 missense probably benign 0.01
R8416:Tiparp UTSW 3 65531346 missense probably benign 0.00
R8487:Tiparp UTSW 3 65546234 missense probably benign 0.06
R8547:Tiparp UTSW 3 65546377 critical splice donor site probably null
R8690:Tiparp UTSW 3 65553542 missense probably benign 0.17
R8750:Tiparp UTSW 3 65552704 missense probably damaging 0.99
R8900:Tiparp UTSW 3 65553182 missense probably damaging 1.00
R8940:Tiparp UTSW 3 65531878 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGATTGGGAACTGGAACCC -3'
(R):5'- ATCTACGCAGTCAGGACTTGTAGG -3'

Sequencing Primer
(F):5'- GAACTGGAACCCTGAGATCCTTG -3'
(R):5'- TCAGGACTTGTAGGAACATCACCTG -3'
Posted On2020-07-13