Incidental Mutation 'R8234:Kcnh4'
ID637278
Institutional Source Beutler Lab
Gene Symbol Kcnh4
Ensembl Gene ENSMUSG00000035355
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 4
SynonymsBEC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8234 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100740376-100759942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100752267 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 391 (N391K)
Ref Sequence ENSEMBL: ENSMUSP00000102984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107361] [ENSMUST00000107363]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107361
AA Change: N391K

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102984
Gene: ENSMUSG00000035355
AA Change: N391K

DomainStartEndE-ValueType
PAS 16 88 1.41e-1 SMART
PAC 94 136 4.88e-5 SMART
low complexity region 155 168 N/A INTRINSIC
Pfam:Ion_trans 226 486 1.5e-32 PFAM
Pfam:Ion_trans_2 412 480 2.3e-12 PFAM
cNMP 556 681 1.27e-12 SMART
low complexity region 726 735 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
coiled coil region 874 911 N/A INTRINSIC
low complexity region 981 1006 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107363
AA Change: N391K

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102986
Gene: ENSMUSG00000035355
AA Change: N391K

DomainStartEndE-ValueType
PAS 16 88 1.41e-1 SMART
PAC 94 136 4.88e-5 SMART
low complexity region 155 168 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Pfam:Ion_trans 265 474 1.1e-17 PFAM
Pfam:Ion_trans_2 412 480 2.2e-12 PFAM
cNMP 556 681 1.27e-12 SMART
low complexity region 726 735 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
coiled coil region 874 911 N/A INTRINSIC
low complexity region 981 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. The gene is brain-specific, and located in the neocortex and the striatum. It may be involved in cellular excitability of restricted neurons in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,753,510 S1180P possibly damaging Het
Abhd4 T A 14: 54,261,676 M38K probably benign Het
Ackr1 T A 1: 173,332,015 R312S probably benign Het
Agpat9 T C 5: 100,857,210 probably null Het
Akap9 T C 5: 4,044,845 V2213A probably benign Het
Alox5 T A 6: 116,413,874 R439W probably damaging Het
Atrn A T 2: 131,023,000 probably null Het
Casd1 A G 6: 4,601,209 N14S probably damaging Het
Cry2 T C 2: 92,412,629 S542G probably benign Het
Cyb5rl A G 4: 107,068,738 Y39C probably damaging Het
Dmpk A T 7: 19,088,123 K335N probably benign Het
Dnaic1 A G 4: 41,625,221 D395G probably benign Het
Dock4 C T 12: 40,834,838 probably null Het
Fmo4 T C 1: 162,805,188 D198G probably damaging Het
Foxc2 G A 8: 121,118,038 R475Q probably damaging Het
Gipr C A 7: 19,164,608 G37V unknown Het
Gm15800 T A 5: 121,339,544 N2843K possibly damaging Het
Gm2046 A T 12: 87,973,738 I71L noncoding transcript Het
Hcn4 A G 9: 58,844,150 D353G unknown Het
Hmcn1 C T 1: 150,594,010 V4973M possibly damaging Het
Il20rb C T 9: 100,459,210 S281N probably benign Het
Kitl A G 10: 100,051,846 T6A probably damaging Het
Krt36 A G 11: 100,104,201 Y182H probably damaging Het
Lrp1b T G 2: 41,312,656 I1262L Het
Mtf1 A G 4: 124,844,246 E644G probably benign Het
Mtx2 A G 2: 74,869,362 Y159C probably damaging Het
Nags C T 11: 102,148,998 S504F probably damaging Het
Ncam1 A T 9: 49,545,223 F475L probably damaging Het
Nipal2 G T 15: 34,600,032 T213N possibly damaging Het
Olfr1098 A G 2: 86,922,969 S188P probably damaging Het
Olfr554 T A 7: 102,640,471 L75Q probably damaging Het
Pkm T C 9: 59,670,599 V233A possibly damaging Het
Pros1 T A 16: 62,928,177 I671N possibly damaging Het
Rasd1 T C 11: 59,964,292 I121V probably damaging Het
Samhd1 A G 2: 157,116,350 probably null Het
Serpinb9f A T 13: 33,325,915 Y30F probably benign Het
Slc5a10 T C 11: 61,673,281 I543V probably benign Het
Stat5a A G 11: 100,879,303 I469V possibly damaging Het
Sugct T C 13: 16,857,874 E431G probably benign Het
Tecr C A 8: 83,573,251 R133L possibly damaging Het
Tiparp A G 3: 65,531,581 N106S probably benign Het
Triml1 T C 8: 43,141,248 S49G probably benign Het
Trpm3 T A 19: 22,715,276 S244T possibly damaging Het
Ttn T C 2: 76,722,980 D31055G probably damaging Het
Vcp A T 4: 42,985,242 I369N probably damaging Het
Vmn2r110 A C 17: 20,584,429 N76K probably benign Het
Vmn2r12 T C 5: 109,086,208 T713A probably benign Het
Vmn2r17 A T 5: 109,453,369 K844N probably benign Het
Other mutations in Kcnh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Kcnh4 APN 11 100756995 splice site probably benign
IGL00430:Kcnh4 APN 11 100757654 missense possibly damaging 0.85
IGL02031:Kcnh4 APN 11 100745823 missense probably damaging 1.00
IGL02346:Kcnh4 APN 11 100756942 missense possibly damaging 0.46
IGL02674:Kcnh4 APN 11 100746894 missense possibly damaging 0.58
IGL02903:Kcnh4 APN 11 100757654 missense possibly damaging 0.50
IGL03152:Kcnh4 APN 11 100745772 missense probably benign 0.00
R0032:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0033:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0066:Kcnh4 UTSW 11 100757800 missense probably benign 0.11
R0066:Kcnh4 UTSW 11 100757800 missense probably benign 0.11
R0242:Kcnh4 UTSW 11 100755699 missense probably damaging 1.00
R0242:Kcnh4 UTSW 11 100755699 missense probably damaging 1.00
R0244:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0310:Kcnh4 UTSW 11 100746169 missense probably benign 0.04
R0330:Kcnh4 UTSW 11 100757743 missense probably damaging 1.00
R0345:Kcnh4 UTSW 11 100757681 missense probably benign 0.08
R0436:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0466:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0468:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0487:Kcnh4 UTSW 11 100750258 missense probably damaging 0.99
R0562:Kcnh4 UTSW 11 100750244 missense possibly damaging 0.80
R0613:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R1077:Kcnh4 UTSW 11 100752338 missense possibly damaging 0.72
R1705:Kcnh4 UTSW 11 100741772 missense probably benign
R1840:Kcnh4 UTSW 11 100745341 missense possibly damaging 0.46
R2114:Kcnh4 UTSW 11 100759595 missense probably damaging 1.00
R4448:Kcnh4 UTSW 11 100755907 missense probably benign 0.00
R4823:Kcnh4 UTSW 11 100755174 missense probably damaging 1.00
R4865:Kcnh4 UTSW 11 100749743 missense probably damaging 1.00
R4963:Kcnh4 UTSW 11 100752253 missense probably damaging 1.00
R4977:Kcnh4 UTSW 11 100746833 missense probably damaging 1.00
R5228:Kcnh4 UTSW 11 100746896 missense probably damaging 1.00
R5385:Kcnh4 UTSW 11 100752250 missense probably damaging 1.00
R5414:Kcnh4 UTSW 11 100746896 missense probably damaging 1.00
R5682:Kcnh4 UTSW 11 100749802 missense possibly damaging 0.82
R5945:Kcnh4 UTSW 11 100745322 missense probably damaging 1.00
R6434:Kcnh4 UTSW 11 100750279 missense probably damaging 0.97
R6505:Kcnh4 UTSW 11 100757085 missense probably benign 0.39
R7263:Kcnh4 UTSW 11 100741817 missense probably benign 0.06
R7270:Kcnh4 UTSW 11 100747646 missense probably benign
R7353:Kcnh4 UTSW 11 100757199 missense probably benign 0.18
R7355:Kcnh4 UTSW 11 100752443 missense possibly damaging 0.92
R7544:Kcnh4 UTSW 11 100757080 missense probably benign 0.25
R7563:Kcnh4 UTSW 11 100741854 missense probably benign 0.00
R7664:Kcnh4 UTSW 11 100750322 missense probably damaging 1.00
R7972:Kcnh4 UTSW 11 100752452 missense probably damaging 0.98
R8146:Kcnh4 UTSW 11 100755279 missense probably damaging 1.00
R8166:Kcnh4 UTSW 11 100741886 missense probably benign
R8295:Kcnh4 UTSW 11 100749697 missense probably benign 0.17
R8318:Kcnh4 UTSW 11 100752328 missense probably damaging 1.00
R8347:Kcnh4 UTSW 11 100757749 missense probably damaging 1.00
R8413:Kcnh4 UTSW 11 100749793 missense possibly damaging 0.60
R8464:Kcnh4 UTSW 11 100757184 missense probably damaging 1.00
X0025:Kcnh4 UTSW 11 100750243 missense possibly damaging 0.91
X0061:Kcnh4 UTSW 11 100756907 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GTCTCCAAACCAGTGTCTCCAC -3'
(R):5'- AAGTGTGCCTGCTAACAGC -3'

Sequencing Primer
(F):5'- CACTTGATCTCCACAGGGC -3'
(R):5'- TCACTGGTACATCTGCTGAAAAC -3'
Posted On2020-07-13