Incidental Mutation 'R8263:Ppp2r2a'
ID639820
Institutional Source Beutler Lab
Gene Symbol Ppp2r2a
Ensembl Gene ENSMUSG00000022052
Gene Nameprotein phosphatase 2, regulatory subunit B, alpha
Synonyms2410004D02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8263 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location67014056-67072444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67023756 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 172 (F172I)
Ref Sequence ENSEMBL: ENSMUSP00000153191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089230] [ENSMUST00000225251] [ENSMUST00000225380]
Predicted Effect probably damaging
Transcript: ENSMUST00000089230
AA Change: F172I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086640
Gene: ENSMUSG00000022052
AA Change: F172I

DomainStartEndE-ValueType
WD40 21 56 1.33e1 SMART
WD40 83 123 6.88e0 SMART
WD40 165 204 2.3e0 SMART
WD40 215 255 8.88e0 SMART
WD40 274 312 5.11e1 SMART
WD40 339 370 1.42e2 SMART
WD40 406 443 2.47e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223630
Predicted Effect probably benign
Transcript: ENSMUST00000225251
Predicted Effect probably damaging
Transcript: ENSMUST00000225380
AA Change: F172I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225469
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T A 1: 75,232,039 R12S unknown Het
Ankrd10 C T 8: 11,615,707 V298I probably benign Het
Atg4d T A 9: 21,267,039 M151K probably damaging Het
Casp8ap2 T A 4: 32,644,072 H1048Q probably damaging Het
Cd300ld2 A G 11: 115,012,366 S218P unknown Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Cnot6 A T 11: 49,682,175 Y241N probably damaging Het
Dnah1 A T 14: 31,293,177 F1686Y probably damaging Het
Dnah12 A G 14: 26,891,464 K1285E noncoding transcript Het
Dopey2 T C 16: 93,762,195 S610P possibly damaging Het
Ehhadh A T 16: 21,773,545 L136H probably damaging Het
Epha7 A G 4: 28,821,149 T105A probably damaging Het
Etl4 A T 2: 20,744,154 E434D probably benign Het
Fam208b C T 13: 3,575,286 V1555I possibly damaging Het
Fam208b G T 13: 3,590,016 P374T probably benign Het
Fam26e C A 10: 34,096,196 C81F probably damaging Het
Fastkd2 T C 1: 63,731,809 V108A probably benign Het
Fat2 G A 11: 55,284,136 T1917I probably benign Het
Fbxo45 A G 16: 32,246,715 S33P unknown Het
Fig4 A T 10: 41,267,715 Y249* probably null Het
Fryl T C 5: 73,081,005 Y1466C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Glod4 T C 11: 76,234,492 D147G possibly damaging Het
Gm12695 T G 4: 96,762,809 M136L probably benign Het
Gm5422 A G 10: 31,249,103 T313A noncoding transcript Het
Hydin C A 8: 110,452,073 A1100D probably benign Het
Ift172 G A 5: 31,265,337 A923V possibly damaging Het
Irgc1 G A 7: 24,432,682 H237Y probably damaging Het
Itga11 T C 9: 62,696,980 I50T possibly damaging Het
Itpr3 C T 17: 27,115,913 Q2134* probably null Het
Kat8 A T 7: 127,924,481 D292V possibly damaging Het
Kdm2a A G 19: 4,324,364 M913T possibly damaging Het
Larp4 T C 15: 99,986,080 V66A probably benign Het
Loxhd1 A G 18: 77,375,162 D899G probably damaging Het
Lrrc47 G T 4: 154,016,029 R354L probably damaging Het
Lss C T 10: 76,531,905 R24C probably damaging Het
Mmp14 C T 14: 54,435,787 R51C probably damaging Het
Mon1a C T 9: 107,898,794 T37I probably benign Het
Nacc2 A C 2: 26,062,228 V372G probably damaging Het
Ncapg T C 5: 45,691,792 V690A probably benign Het
Nhej1 A G 1: 74,967,737 L152P probably damaging Het
Nol4l A T 2: 153,417,417 S522R probably damaging Het
Nr0b2 A G 4: 133,553,930 Y169C probably damaging Het
Numa1 A G 7: 101,999,284 M741V probably benign Het
Olfr149 A G 9: 39,702,157 M204T possibly damaging Het
Olfr945 A G 9: 39,258,603 L26P probably damaging Het
Pebp1 C A 5: 117,287,408 probably null Het
Pik3ip1 A T 11: 3,341,581 I217F probably damaging Het
Plekhg1 T A 10: 3,957,651 I911N Het
Pnpla8 T C 12: 44,296,063 I534T probably damaging Het
Rab7 C T 6: 88,012,310 M59I probably benign Het
Rbm34 T C 8: 126,965,389 N201S probably benign Het
Rfx1 G T 8: 84,094,854 R764L probably damaging Het
Rnase12 T A 14: 51,057,123 D33V probably damaging Het
Rnf121 A G 7: 102,035,325 L127P probably damaging Het
Rtl1 C A 12: 109,593,746 R553L probably damaging Het
Scn8a T C 15: 100,983,855 L601P probably damaging Het
Scyl2 G T 10: 89,640,663 Q867K possibly damaging Het
Sgtb T C 13: 104,132,184 F213L probably benign Het
Slc35f4 A G 14: 49,313,627 V260A probably damaging Het
Slfn14 A G 11: 83,283,473 Y231H possibly damaging Het
Soga1 A G 2: 157,027,590 W1042R possibly damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stard13 G A 5: 151,233,641 A25V possibly damaging Het
Stk38 C T 17: 28,984,187 R135H probably damaging Het
Svil A G 18: 5,108,679 D1939G probably damaging Het
Tbc1d7 A G 13: 43,169,864 V17A possibly damaging Het
Trpc4 T C 3: 54,222,335 V174A probably damaging Het
Ttn G T 2: 76,788,684 T16117K probably damaging Het
Tubb3 T A 8: 123,421,129 M267K possibly damaging Het
Upk1b T C 16: 38,784,223 T147A probably damaging Het
Vmn2r107 G T 17: 20,360,352 C517F probably damaging Het
Vmn2r112 A G 17: 22,605,159 D465G probably damaging Het
Vmn2r73 A T 7: 85,858,411 H564Q probably benign Het
Vmn2r79 A G 7: 87,037,518 I702M possibly damaging Het
Vmn2r84 A G 10: 130,391,168 V267A probably damaging Het
Zfp445 T C 9: 122,852,813 I688V probably benign Het
Zfp955a C T 17: 33,244,113 V15M probably damaging Het
Zfp960 T A 17: 17,087,940 C305* probably null Het
Zfp964 A G 8: 69,663,695 D315G possibly damaging Het
Zmynd10 T A 9: 107,549,317 I183K possibly damaging Het
Other mutations in Ppp2r2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Ppp2r2a APN 14 67070277 missense probably damaging 0.96
IGL01997:Ppp2r2a APN 14 67016519 missense probably benign
IGL02024:Ppp2r2a APN 14 67038912 missense probably benign 0.06
IGL02178:Ppp2r2a APN 14 67023097 missense probably damaging 1.00
IGL03148:Ppp2r2a APN 14 67022295 missense probably benign 0.00
IGL03304:Ppp2r2a APN 14 67016528 missense probably benign 0.13
limber UTSW 14 67019804 missense probably damaging 1.00
R1216:Ppp2r2a UTSW 14 67028998 nonsense probably null
R1576:Ppp2r2a UTSW 14 67038869 splice site probably benign
R1629:Ppp2r2a UTSW 14 67019759 missense possibly damaging 0.93
R1662:Ppp2r2a UTSW 14 67016603 missense probably benign
R1808:Ppp2r2a UTSW 14 67038963 missense probably damaging 1.00
R1937:Ppp2r2a UTSW 14 67016429 missense possibly damaging 0.93
R2121:Ppp2r2a UTSW 14 67023128 missense probably damaging 1.00
R2134:Ppp2r2a UTSW 14 67016475 missense possibly damaging 0.63
R3150:Ppp2r2a UTSW 14 67023765 missense probably damaging 1.00
R3694:Ppp2r2a UTSW 14 67019750 missense probably damaging 1.00
R3695:Ppp2r2a UTSW 14 67019750 missense probably damaging 1.00
R3825:Ppp2r2a UTSW 14 67022443 missense probably damaging 0.98
R4031:Ppp2r2a UTSW 14 67028976 missense probably damaging 1.00
R4209:Ppp2r2a UTSW 14 67028879 missense probably damaging 1.00
R4353:Ppp2r2a UTSW 14 67028937 missense probably damaging 1.00
R4639:Ppp2r2a UTSW 14 67038957 missense probably damaging 1.00
R4976:Ppp2r2a UTSW 14 67016637 missense possibly damaging 0.71
R5001:Ppp2r2a UTSW 14 67022308 nonsense probably null
R5106:Ppp2r2a UTSW 14 67023097 missense probably damaging 1.00
R5322:Ppp2r2a UTSW 14 67038873 critical splice donor site probably null
R5360:Ppp2r2a UTSW 14 67016571 nonsense probably null
R5429:Ppp2r2a UTSW 14 67023756 missense probably damaging 1.00
R5439:Ppp2r2a UTSW 14 67022323 missense possibly damaging 0.70
R6250:Ppp2r2a UTSW 14 67038954 missense probably damaging 1.00
R6582:Ppp2r2a UTSW 14 67019804 missense probably damaging 1.00
R8315:Ppp2r2a UTSW 14 67023728 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGACTCAAATATATCTAGGAGAG -3'
(R):5'- TGCTTAACAGAACCAACATCAGTG -3'

Sequencing Primer
(F):5'- TAGGAGAGAAGATAAATCTAATGGGG -3'
(R):5'- TCATGGTCTTGTGACTCTT -3'
Posted On2020-07-28