Incidental Mutation 'R4353:Ppp2r2a'
ID327433
Institutional Source Beutler Lab
Gene Symbol Ppp2r2a
Ensembl Gene ENSMUSG00000022052
Gene Nameprotein phosphatase 2, regulatory subunit B, alpha
Synonyms2410004D02Rik
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location67014056-67072444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67028937 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 92 (I92L)
Ref Sequence ENSEMBL: ENSMUSP00000153191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089230] [ENSMUST00000225251] [ENSMUST00000225380]
Predicted Effect probably damaging
Transcript: ENSMUST00000089230
AA Change: I92L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086640
Gene: ENSMUSG00000022052
AA Change: I92L

DomainStartEndE-ValueType
WD40 21 56 1.33e1 SMART
WD40 83 123 6.88e0 SMART
WD40 165 204 2.3e0 SMART
WD40 215 255 8.88e0 SMART
WD40 274 312 5.11e1 SMART
WD40 339 370 1.42e2 SMART
WD40 406 443 2.47e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223630
Predicted Effect probably benign
Transcript: ENSMUST00000225251
Predicted Effect probably damaging
Transcript: ENSMUST00000225380
AA Change: I92L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225469
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Ppp2r2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Ppp2r2a APN 14 67070277 missense probably damaging 0.96
IGL01997:Ppp2r2a APN 14 67016519 missense probably benign
IGL02024:Ppp2r2a APN 14 67038912 missense probably benign 0.06
IGL02178:Ppp2r2a APN 14 67023097 missense probably damaging 1.00
IGL03148:Ppp2r2a APN 14 67022295 missense probably benign 0.00
IGL03304:Ppp2r2a APN 14 67016528 missense probably benign 0.13
limber UTSW 14 67019804 missense probably damaging 1.00
R1216:Ppp2r2a UTSW 14 67028998 nonsense probably null
R1576:Ppp2r2a UTSW 14 67038869 splice site probably benign
R1629:Ppp2r2a UTSW 14 67019759 missense possibly damaging 0.93
R1662:Ppp2r2a UTSW 14 67016603 missense probably benign
R1808:Ppp2r2a UTSW 14 67038963 missense probably damaging 1.00
R1937:Ppp2r2a UTSW 14 67016429 missense possibly damaging 0.93
R2121:Ppp2r2a UTSW 14 67023128 missense probably damaging 1.00
R2134:Ppp2r2a UTSW 14 67016475 missense possibly damaging 0.63
R3150:Ppp2r2a UTSW 14 67023765 missense probably damaging 1.00
R3694:Ppp2r2a UTSW 14 67019750 missense probably damaging 1.00
R3695:Ppp2r2a UTSW 14 67019750 missense probably damaging 1.00
R3825:Ppp2r2a UTSW 14 67022443 missense probably damaging 0.98
R4031:Ppp2r2a UTSW 14 67028976 missense probably damaging 1.00
R4209:Ppp2r2a UTSW 14 67028879 missense probably damaging 1.00
R4639:Ppp2r2a UTSW 14 67038957 missense probably damaging 1.00
R4976:Ppp2r2a UTSW 14 67016637 missense possibly damaging 0.71
R5001:Ppp2r2a UTSW 14 67022308 nonsense probably null
R5106:Ppp2r2a UTSW 14 67023097 missense probably damaging 1.00
R5322:Ppp2r2a UTSW 14 67038873 critical splice donor site probably null
R5360:Ppp2r2a UTSW 14 67016571 nonsense probably null
R5429:Ppp2r2a UTSW 14 67023756 missense probably damaging 1.00
R5439:Ppp2r2a UTSW 14 67022323 missense possibly damaging 0.70
R6250:Ppp2r2a UTSW 14 67038954 missense probably damaging 1.00
R6582:Ppp2r2a UTSW 14 67019804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGGGCCTATATCCTCTACAGG -3'
(R):5'- CGATAAAGCAGCCTAGTTGGG -3'

Sequencing Primer
(F):5'- TCCTCTACAGGACACGTGC -3'
(R):5'- TAAAGCAGCCTAGTTGGGGTATCTAC -3'
Posted On2015-07-07