Mutagenetix > Incidental Mutations

Incidental Mutation 'R4353:Ppp2r2a'

327433

Institutional Source

Beutler Lab

Gene Symbol

Ppp2r2a

Ensembl Gene

ENSMUSG00000022052

Gene Name

protein phosphatase 2, regulatory subunit B, alpha

Synonyms

2410004D02Rik

MMRRC Submission

040866-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4353 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67014056-67072444 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67028937 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 92 (I92L)

Ref Sequence

ENSEMBL: ENSMUSP00000153191 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089230] [ENSMUST00000225251] [ENSMUST00000225380]

Predicted Effect

probably damaging
Transcript: ENSMUST00000089230
AA Change: I92L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000086640
Gene: ENSMUSG00000022052
AA Change: I92L

Domain	Start	End	E-Value	Type
WD40	21	56	1.33e1	SMART
WD40	83	123	6.88e0	SMART
WD40	165	204	2.3e0	SMART
WD40	215	255	8.88e0	SMART
WD40	274	312	5.11e1	SMART
WD40	339	370	1.42e2	SMART
WD40	406	443	2.47e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223630

Predicted Effect

probably benign
Transcript: ENSMUST00000225251

Predicted Effect

probably damaging
Transcript: ENSMUST00000225380
AA Change: I92L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225469

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933425L06Rik	T	C	13: 105,118,745	Y445H	probably benign	Het
5730559C18Rik	C	T	1: 136,226,208	V180I	probably damaging	Het
A2ml1	C	T	6: 128,580,386	A115T	probably benign	Het
Alpk2	C	T	18: 65,291,452	R1888H	possibly damaging	Het
Arhgap33	C	A	7: 30,524,136	V823L	possibly damaging	Het
Atp2b2	T	C	6: 113,765,784	I736V	probably benign	Het
Atp8a1	T	C	5: 67,769,108	T260A	probably damaging	Het
B4galnt3	T	C	6: 120,215,476	E433G	possibly damaging	Het
Bzw2	A	T	12: 36,123,979	F99I	probably damaging	Het
Cdh20	A	G	1: 104,979,089	D547G	probably damaging	Het
Col27a1	G	T	4: 63,225,631	A519S	probably benign	Het
Coq6	G	A	12: 84,368,149	G110D	probably damaging	Het
Cpb1	T	C	3: 20,262,544	T281A	probably benign	Het
Cttnbp2	T	C	6: 18,514,704	D11G	probably benign	Het
Cyp2c37	A	G	19: 40,000,545	Y316C	possibly damaging	Het
Dcdc2a	T	A	13: 25,056,491	I74N	probably damaging	Het
Dhx9	A	G	1: 153,471,789	L391P	probably damaging	Het
Dsc2	G	T	18: 20,050,068	L98I	probably damaging	Het
Dthd1	T	A	5: 62,842,867	S511T	probably benign	Het
Dusp2	A	G	2: 127,337,336	T204A	probably damaging	Het
Elovl5	T	C	9: 77,960,917	V37A	probably benign	Het
Etv1	A	G	12: 38,857,106	E369G	probably damaging	Het
Gem	G	A	4: 11,705,939	R9H	probably damaging	Het
Heg1	A	G	16: 33,710,477	T108A	probably benign	Het
Iqgap2	C	T	13: 95,671,396	V788M	probably damaging	Het
Kyat3	T	C	3: 142,731,293		probably null	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
Mecom	C	A	3: 29,966,738	V452L	possibly damaging	Het
Meis2	A	G	2: 116,059,563	M146T	probably damaging	Het
Nrp2	A	G	1: 62,738,417	D127G	probably damaging	Het
Nup214	T	C	2: 31,977,917		probably null	Het
Olfr93	T	A	17: 37,151,337	I58F	probably damaging	Het
Pabpc4	C	T	4: 123,290,267	T191I	probably damaging	Het
Pcnx2	T	C	8: 125,762,851	H1668R	probably damaging	Het
Poln	C	T	5: 34,129,452	C124Y	probably benign	Het
Prpmp5	T	G	6: 132,313,661	Y25S	unknown	Het
Ptch1	C	T	13: 63,534,329	R537H	probably damaging	Het
Rnf130	T	C	11: 50,087,440	V276A	possibly damaging	Het
Rnf31	AAC	A	14: 55,601,098		probably null	Het
Rnf38	A	T	4: 44,149,100	N82K	possibly damaging	Het
Scn7a	T	A	2: 66,676,436	M1370L	probably benign	Het
Sema4b	C	A	7: 80,215,651	L125I	probably damaging	Het
Slc12a7	C	T	13: 73,790,734	T210I	possibly damaging	Het
Sox8	A	C	17: 25,567,335	*465G	probably null	Het
Spg11	G	T	2: 122,113,194	T159K	possibly damaging	Het
Stk36	A	G	1: 74,632,807	R889G	possibly damaging	Het
Tmbim7	A	G	5: 3,661,796	S14G	probably benign	Het
Usp16	A	G	16: 87,470,354	N211D	probably damaging	Het
Vmn1r6	C	T	6: 57,002,692	A113V	possibly damaging	Het
Zc3h14	A	G	12: 98,763,960	N92D	possibly damaging	Het
Zfp638	T	C	6: 83,984,059	S1206P	probably damaging	Het

Other mutations in Ppp2r2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01620:Ppp2r2a	APN	14	67070277	missense	probably damaging	0.96
IGL01997:Ppp2r2a	APN	14	67016519	missense	probably benign
IGL02024:Ppp2r2a	APN	14	67038912	missense	probably benign	0.06
IGL02178:Ppp2r2a	APN	14	67023097	missense	probably damaging	1.00
IGL03148:Ppp2r2a	APN	14	67022295	missense	probably benign	0.00
IGL03304:Ppp2r2a	APN	14	67016528	missense	probably benign	0.13
limber	UTSW	14	67019804	missense	probably damaging	1.00
R1216:Ppp2r2a	UTSW	14	67028998	nonsense	probably null
R1576:Ppp2r2a	UTSW	14	67038869	splice site	probably benign
R1629:Ppp2r2a	UTSW	14	67019759	missense	possibly damaging	0.93
R1662:Ppp2r2a	UTSW	14	67016603	missense	probably benign
R1808:Ppp2r2a	UTSW	14	67038963	missense	probably damaging	1.00
R1937:Ppp2r2a	UTSW	14	67016429	missense	possibly damaging	0.93
R2121:Ppp2r2a	UTSW	14	67023128	missense	probably damaging	1.00
R2134:Ppp2r2a	UTSW	14	67016475	missense	possibly damaging	0.63
R3150:Ppp2r2a	UTSW	14	67023765	missense	probably damaging	1.00
R3694:Ppp2r2a	UTSW	14	67019750	missense	probably damaging	1.00
R3695:Ppp2r2a	UTSW	14	67019750	missense	probably damaging	1.00
R3825:Ppp2r2a	UTSW	14	67022443	missense	probably damaging	0.98
R4031:Ppp2r2a	UTSW	14	67028976	missense	probably damaging	1.00
R4209:Ppp2r2a	UTSW	14	67028879	missense	probably damaging	1.00
R4639:Ppp2r2a	UTSW	14	67038957	missense	probably damaging	1.00
R4976:Ppp2r2a	UTSW	14	67016637	missense	possibly damaging	0.71
R5001:Ppp2r2a	UTSW	14	67022308	nonsense	probably null
R5106:Ppp2r2a	UTSW	14	67023097	missense	probably damaging	1.00
R5322:Ppp2r2a	UTSW	14	67038873	critical splice donor site	probably null
R5360:Ppp2r2a	UTSW	14	67016571	nonsense	probably null
R5429:Ppp2r2a	UTSW	14	67023756	missense	probably damaging	1.00
R5439:Ppp2r2a	UTSW	14	67022323	missense	possibly damaging	0.70
R6250:Ppp2r2a	UTSW	14	67038954	missense	probably damaging	1.00
R6582:Ppp2r2a	UTSW	14	67019804	missense	probably damaging	1.00
R8263:Ppp2r2a	UTSW	14	67023756	missense	probably damaging	1.00
R8315:Ppp2r2a	UTSW	14	67023728	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAGGGCCTATATCCTCTACAGG -3'
(R):5'- CGATAAAGCAGCCTAGTTGGG -3'

Sequencing Primer
(F):5'- TCCTCTACAGGACACGTGC -3'
(R):5'- TAAAGCAGCCTAGTTGGGGTATCTAC -3'

Posted On

2015-07-07