Incidental Mutation 'R8252:Hecw1'
ID640200
Institutional Source Beutler Lab
Gene Symbol Hecw1
Ensembl Gene ENSMUSG00000021301
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
SynonymsE130207I19Rik, NEDL1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8252 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location14226438-14523228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 14340840 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 236 (G236W)
Ref Sequence ENSEMBL: ENSMUSP00000106145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110516]
Predicted Effect probably damaging
Transcript: ENSMUST00000110516
AA Change: G236W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106145
Gene: ENSMUSG00000021301
AA Change: G236W

DomainStartEndE-ValueType
Pfam:HECW_N 65 184 6.5e-62 PFAM
C2 206 317 1.02e-12 SMART
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 677 704 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
WW 827 859 8.66e-13 SMART
coiled coil region 873 898 N/A INTRINSIC
low complexity region 917 930 N/A INTRINSIC
WW 1017 1049 5.59e-7 SMART
Blast:HECTc 1137 1192 3e-26 BLAST
low complexity region 1193 1208 N/A INTRINSIC
low complexity region 1212 1223 N/A INTRINSIC
HECTc 1267 1604 1.36e-185 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A G 10: 88,981,019 I644T probably damaging Het
Arhgap18 T A 10: 26,854,936 D203E probably benign Het
Ascc3 T A 10: 50,642,610 M337K probably benign Het
Atg13 G C 2: 91,680,354 P343A probably benign Het
Cacna1c C T 6: 118,657,374 V1058I Het
Cd180 A G 13: 102,705,996 T517A probably benign Het
Cd1d2 A C 3: 86,987,068 I48L probably benign Het
Cdh19 C T 1: 110,889,885 C709Y probably benign Het
Chst10 T C 1: 38,884,352 D51G probably benign Het
Clec2g G A 6: 128,981,372 E184K probably benign Het
Col19a1 T A 1: 24,279,967 H1014L probably benign Het
Fam135b T A 15: 71,533,023 H58L probably benign Het
Fam171b A G 2: 83,878,242 I363V probably benign Het
Htra3 A G 5: 35,652,961 M459T probably benign Het
Iglc2 A T 16: 19,198,770 C27* probably null Het
Il1f8 A T 2: 24,158,813 T77S possibly damaging Het
Kif1b A T 4: 149,273,805 N135K probably damaging Het
Krt5 A T 15: 101,712,359 I151N probably damaging Het
Lama4 A T 10: 39,060,146 M606L probably benign Het
Lgr6 T A 1: 135,003,477 S280C probably null Het
Msh3 T A 13: 92,221,061 T967S probably damaging Het
Mum1 A G 10: 80,241,860 I656V probably benign Het
Ndufb4 T C 16: 37,654,275 T29A probably benign Het
Nfe2l1 T C 11: 96,819,232 M724V probably benign Het
Nudt12 T C 17: 59,011,094 Y52C probably damaging Het
Nutm1 G T 2: 112,251,829 Q301K probably damaging Het
Olfr1189 A G 2: 88,592,667 R288G probably damaging Het
Olfr325 T A 11: 58,581,132 I96N probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr49 T A 14: 54,282,247 Y216F possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pcdha11 G C 18: 37,007,537 V740L possibly damaging Het
Pkd1l2 T C 8: 117,040,733 T1273A probably benign Het
Pla2g4a T C 1: 149,851,307 D574G probably damaging Het
Prrc2b A T 2: 32,219,380 Q1719L possibly damaging Het
Psap A G 10: 60,277,689 probably benign Het
Rab11fip2 C T 19: 59,936,990 S265N probably benign Het
Rnf10 A T 5: 115,260,314 D53E probably benign Het
Scgb2b11 T C 7: 32,209,339 E112G probably benign Het
Scml4 T C 10: 42,924,104 Y85H noncoding transcript Het
Setd5 T A 6: 113,150,955 Y1290N probably benign Het
Sgk1 T A 10: 21,997,399 C375S probably damaging Het
Sik2 A G 9: 50,917,115 V209A possibly damaging Het
Sipa1l2 A T 8: 125,468,671 V776D probably damaging Het
Slamf1 T A 1: 171,767,228 M1K probably null Het
Slc26a7 T C 4: 14,621,415 probably benign Het
Sry C A Y: 2,663,298 A121S possibly damaging Het
Sspo C T 6: 48,485,452 T3719I probably damaging Het
Tcap T C 11: 98,384,345 S102P probably benign Het
Thap7 T C 16: 17,528,622 R166G probably benign Het
Tmem229a T C 6: 24,955,581 Y58C probably damaging Het
Trim8 A G 19: 46,515,620 Y537C probably damaging Het
Ubr4 T A 4: 139,473,217 M4692K unknown Het
Uvssa A G 5: 33,392,179 S395G probably benign Het
Vgll4 G T 6: 114,890,734 T52K probably damaging Het
Vmn2r7 A G 3: 64,693,106 L548P probably benign Het
Vmn2r92 T A 17: 18,166,872 S158T probably damaging Het
Zbtb48 A T 4: 152,020,887 C463S probably damaging Het
Other mutations in Hecw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Hecw1 APN 13 14265980 missense possibly damaging 0.71
IGL00813:Hecw1 APN 13 14278376 critical splice acceptor site probably null
IGL00843:Hecw1 APN 13 14247573 missense probably benign 0.02
IGL00942:Hecw1 APN 13 14340740 splice site probably benign
IGL00976:Hecw1 APN 13 14318972 missense probably damaging 1.00
IGL01289:Hecw1 APN 13 14264134 missense probably damaging 1.00
IGL01675:Hecw1 APN 13 14234422 missense probably damaging 1.00
IGL01783:Hecw1 APN 13 14278293 missense probably damaging 1.00
IGL01941:Hecw1 APN 13 14316310 missense probably benign 0.01
IGL02170:Hecw1 APN 13 14264158 missense possibly damaging 0.75
IGL02172:Hecw1 APN 13 14264149 missense probably damaging 1.00
IGL02214:Hecw1 APN 13 14300393 missense probably damaging 1.00
IGL02350:Hecw1 APN 13 14248338 splice site probably null
IGL02357:Hecw1 APN 13 14248338 splice site probably null
IGL02372:Hecw1 APN 13 14264121 missense probably damaging 1.00
IGL02591:Hecw1 APN 13 14357236 splice site probably benign
IGL02718:Hecw1 APN 13 14306935 critical splice acceptor site probably null
IGL02795:Hecw1 APN 13 14322517 missense probably damaging 1.00
IGL02941:Hecw1 APN 13 14377726 missense probably damaging 1.00
IGL03256:Hecw1 APN 13 14280484 missense probably damaging 0.99
IGL03256:Hecw1 APN 13 14280485 missense probably benign 0.36
IGL03366:Hecw1 APN 13 14377797 missense probably damaging 1.00
deflated UTSW 13 14247620 missense possibly damaging 0.69
Demoralized UTSW 13 14316818 nonsense probably null
Letdown UTSW 13 14316492 missense probably benign 0.40
BB001:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
BB011:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
IGL03014:Hecw1 UTSW 13 14245808 missense probably damaging 1.00
PIT4378001:Hecw1 UTSW 13 14377783 missense probably damaging 0.98
R0555:Hecw1 UTSW 13 14236941 missense probably damaging 1.00
R0617:Hecw1 UTSW 13 14280442 missense probably benign 0.44
R1476:Hecw1 UTSW 13 14306086 missense probably damaging 1.00
R1479:Hecw1 UTSW 13 14316492 missense probably benign 0.40
R1551:Hecw1 UTSW 13 14316943 missense probably damaging 1.00
R1579:Hecw1 UTSW 13 14377907 missense probably damaging 1.00
R1584:Hecw1 UTSW 13 14340743 critical splice donor site probably null
R1735:Hecw1 UTSW 13 14377765 missense probably null 0.09
R1872:Hecw1 UTSW 13 14280449 nonsense probably null
R1897:Hecw1 UTSW 13 14377940 missense probably damaging 1.00
R2054:Hecw1 UTSW 13 14297413 missense probably damaging 0.97
R2085:Hecw1 UTSW 13 14264087 missense possibly damaging 0.93
R2134:Hecw1 UTSW 13 14377700 missense probably damaging 1.00
R2172:Hecw1 UTSW 13 14377706 missense probably damaging 1.00
R2258:Hecw1 UTSW 13 14316138 missense probably benign 0.01
R2274:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2275:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2937:Hecw1 UTSW 13 14245836 missense possibly damaging 0.93
R3830:Hecw1 UTSW 13 14346058 missense probably benign 0.13
R3971:Hecw1 UTSW 13 14236929 missense probably damaging 1.00
R4065:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4066:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4235:Hecw1 UTSW 13 14317139 missense probably benign 0.42
R4366:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4382:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4385:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4510:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4511:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4558:Hecw1 UTSW 13 14247605 missense probably damaging 0.99
R4804:Hecw1 UTSW 13 14305985 missense probably benign 0.00
R4854:Hecw1 UTSW 13 14316892 missense probably benign 0.00
R5104:Hecw1 UTSW 13 14340792 missense probably damaging 1.00
R5113:Hecw1 UTSW 13 14346029 missense possibly damaging 0.94
R5167:Hecw1 UTSW 13 14285657 missense probably damaging 1.00
R5392:Hecw1 UTSW 13 14245762 missense probably damaging 1.00
R5394:Hecw1 UTSW 13 14322589 missense probably damaging 1.00
R5504:Hecw1 UTSW 13 14340902 missense probably benign 0.04
R5764:Hecw1 UTSW 13 14322509 missense probably damaging 1.00
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6228:Hecw1 UTSW 13 14346038 missense probably damaging 1.00
R6247:Hecw1 UTSW 13 14234425 nonsense probably null
R6252:Hecw1 UTSW 13 14272079 missense probably damaging 0.98
R6291:Hecw1 UTSW 13 14523007 unclassified probably benign
R6321:Hecw1 UTSW 13 14522829 missense probably benign 0.00
R6325:Hecw1 UTSW 13 14316446 missense probably damaging 1.00
R6328:Hecw1 UTSW 13 14247620 missense possibly damaging 0.69
R6557:Hecw1 UTSW 13 14316646 missense possibly damaging 0.78
R6566:Hecw1 UTSW 13 14297283 missense probably damaging 1.00
R6597:Hecw1 UTSW 13 14316818 nonsense probably null
R6821:Hecw1 UTSW 13 14264134 missense probably damaging 1.00
R6914:Hecw1 UTSW 13 14316838 missense probably damaging 0.99
R7078:Hecw1 UTSW 13 14434459 start codon destroyed probably null 0.21
R7114:Hecw1 UTSW 13 14311771 missense probably benign 0.02
R7140:Hecw1 UTSW 13 14316533 missense probably benign
R7150:Hecw1 UTSW 13 14434460 start codon destroyed probably benign
R7288:Hecw1 UTSW 13 14316236 missense probably benign 0.00
R7447:Hecw1 UTSW 13 14357204 missense probably damaging 1.00
R7479:Hecw1 UTSW 13 14340840 missense probably damaging 1.00
R7552:Hecw1 UTSW 13 14316250 missense probably damaging 0.99
R7590:Hecw1 UTSW 13 14264083 missense probably damaging 1.00
R7787:Hecw1 UTSW 13 14318909 missense probably damaging 1.00
R7803:Hecw1 UTSW 13 14234342 missense probably benign 0.25
R7924:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
R7967:Hecw1 UTSW 13 14377747 missense probably damaging 1.00
R8195:Hecw1 UTSW 13 14306107 missense probably damaging 0.99
RF001:Hecw1 UTSW 13 14297424 missense probably damaging 1.00
X0020:Hecw1 UTSW 13 14230723 missense possibly damaging 0.52
X0066:Hecw1 UTSW 13 14280460 missense probably benign 0.13
Z1176:Hecw1 UTSW 13 14300333 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GCAGAGAGGTGGGTTTATCAC -3'
(R):5'- GTATTCTGTGCAGGTACAAATCAG -3'

Sequencing Primer
(F):5'- CAGTGTTGCCTATGATCG -3'
(R):5'- TCACCAACTGAGGATGAGTGTTC -3'
Posted On2020-07-28