Incidental Mutation 'R0109:Frmpd1'
ID64192
Institutional Source Beutler Lab
Gene Symbol Frmpd1
Ensembl Gene ENSMUSG00000035615
Gene NameFERM and PDZ domain containing 1
Synonyms
MMRRC Submission 038395-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0109 (G1)
Quality Score175
Status Not validated
Chromosome4
Chromosomal Location45184875-45285936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45279340 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 688 (E688D)
Ref Sequence ENSEMBL: ENSMUSP00000103434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044773] [ENSMUST00000107804]
Predicted Effect probably benign
Transcript: ENSMUST00000044773
AA Change: E688D

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047232
Gene: ENSMUSG00000035615
AA Change: E688D

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107804
AA Change: E688D

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103434
Gene: ENSMUSG00000035615
AA Change: E688D

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,318,762 K1496* probably null Het
Anapc1 C A 2: 128,634,693 R1335L probably damaging Het
Arhgef10l A T 4: 140,578,294 S203T probably benign Het
Astn1 C T 1: 158,664,104 T41I possibly damaging Het
Avil A G 10: 127,013,644 N603S probably benign Het
Brca1 T C 11: 101,531,090 D149G possibly damaging Het
Col19a1 A C 1: 24,559,768 probably null Het
Cps1 T C 1: 67,229,418 V1435A possibly damaging Het
Cyp2j6 A T 4: 96,518,157 I459N probably damaging Het
Cyth1 T C 11: 118,182,306 E242G probably damaging Het
Dclk3 T G 9: 111,467,670 L94R possibly damaging Het
Dsg3 T C 18: 20,540,134 V954A probably damaging Het
Dync2h1 T A 9: 7,111,487 D309V probably damaging Het
Efhd2 A G 4: 141,874,567 F101L probably benign Het
Fgd5 T A 6: 91,988,235 M325K possibly damaging Het
Fras1 T C 5: 96,710,077 S2077P probably benign Het
Hspg2 T C 4: 137,562,201 V3824A probably benign Het
Kctd16 A G 18: 40,259,151 E264G probably benign Het
Mapk15 A T 15: 75,996,077 K153* probably null Het
Miox G A 15: 89,335,581 V91I probably benign Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Olfr1241 A G 2: 89,482,803 F111L probably benign Het
Olfr1442 C A 19: 12,674,860 F218L probably benign Het
Olfr646 T C 7: 104,106,605 S109P probably damaging Het
Parp9 T C 16: 35,948,341 I64T probably damaging Het
Pfkfb4 T C 9: 108,998,889 V43A probably benign Het
Pgap1 A T 1: 54,494,825 V643E probably damaging Het
Pip5k1b T A 19: 24,379,047 M176L probably benign Het
Ppfia4 A T 1: 134,324,217 probably null Het
Prdx2 G A 8: 84,970,251 G4S probably benign Het
Rin3 A G 12: 102,313,081 I50V possibly damaging Het
Rtl1 G A 12: 109,595,407 probably benign Het
Sgsm3 G C 15: 81,009,466 D434H probably damaging Het
Shank2 T C 7: 144,410,577 S634P possibly damaging Het
Sik2 A G 9: 50,899,475 M447T possibly damaging Het
Sla2 A G 2: 156,883,587 probably null Het
Spata16 T A 3: 26,913,267 F389I probably damaging Het
Srebf1 G A 11: 60,201,804 A793V probably benign Het
Tmed11 T A 5: 108,777,412 D178V probably damaging Het
Traf7 A G 17: 24,513,926 F110L probably benign Het
Ttn T A 2: 76,725,564 I30366F probably damaging Het
Ubqlnl C T 7: 104,150,192 V33M probably damaging Het
Vmn1r194 A G 13: 22,245,047 Y278C probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r114 A T 17: 23,310,575 Y184* probably null Het
Vmn2r53 C T 7: 12,582,066 A609T probably damaging Het
Vps13b A G 15: 35,572,119 T961A probably benign Het
Xirp2 T A 2: 67,519,278 N3272K probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp454 T A 11: 50,883,775 T24S possibly damaging Het
Other mutations in Frmpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Frmpd1 APN 4 45279456 missense possibly damaging 0.61
IGL01678:Frmpd1 APN 4 45243717 missense probably damaging 1.00
IGL01815:Frmpd1 APN 4 45284239 missense probably benign
IGL02305:Frmpd1 APN 4 45249209 missense probably damaging 1.00
IGL02347:Frmpd1 APN 4 45270023 splice site probably null
IGL02586:Frmpd1 APN 4 45285160 missense probably damaging 1.00
IGL02704:Frmpd1 APN 4 45285082 missense possibly damaging 0.83
IGL02942:Frmpd1 APN 4 45285493 missense probably damaging 0.99
IGL03353:Frmpd1 APN 4 45261926 missense probably damaging 1.00
IGL03355:Frmpd1 APN 4 45279140 missense probably damaging 1.00
IGL03401:Frmpd1 APN 4 45284383 missense probably benign 0.28
IGL03047:Frmpd1 UTSW 4 45283993 missense probably damaging 1.00
R0094:Frmpd1 UTSW 4 45284899 nonsense probably null
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0375:Frmpd1 UTSW 4 45284196 missense probably benign 0.00
R0508:Frmpd1 UTSW 4 45284938 missense unknown
R0524:Frmpd1 UTSW 4 45256902 missense probably damaging 1.00
R0524:Frmpd1 UTSW 4 45283774 missense probably benign 0.00
R0625:Frmpd1 UTSW 4 45284055 missense probably benign
R0825:Frmpd1 UTSW 4 45285394 missense possibly damaging 0.93
R0926:Frmpd1 UTSW 4 45268497 missense probably damaging 1.00
R0975:Frmpd1 UTSW 4 45279000 missense probably benign 0.01
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1573:Frmpd1 UTSW 4 45283932 missense probably benign 0.01
R1938:Frmpd1 UTSW 4 45283711 missense probably damaging 1.00
R2334:Frmpd1 UTSW 4 45285408 missense probably damaging 0.97
R2413:Frmpd1 UTSW 4 45278969 missense probably benign 0.02
R2760:Frmpd1 UTSW 4 45244667 missense possibly damaging 0.77
R3856:Frmpd1 UTSW 4 45283698 missense probably damaging 1.00
R3876:Frmpd1 UTSW 4 45284093 missense probably benign 0.01
R4080:Frmpd1 UTSW 4 45284382 missense probably benign
R4597:Frmpd1 UTSW 4 45274441 missense probably benign 0.12
R4714:Frmpd1 UTSW 4 45284785 missense probably benign 0.11
R4779:Frmpd1 UTSW 4 45229865 missense probably damaging 1.00
R4957:Frmpd1 UTSW 4 45273099 missense probably damaging 1.00
R5000:Frmpd1 UTSW 4 45261931 splice site probably null
R5041:Frmpd1 UTSW 4 45278878 missense probably damaging 1.00
R5228:Frmpd1 UTSW 4 45284322 missense probably damaging 0.98
R5413:Frmpd1 UTSW 4 45249196 missense probably benign 0.00
R5560:Frmpd1 UTSW 4 45243697 missense probably damaging 1.00
R6133:Frmpd1 UTSW 4 45284915 missense probably benign 0.01
R6158:Frmpd1 UTSW 4 45285401 missense probably damaging 1.00
R6329:Frmpd1 UTSW 4 45268551 missense possibly damaging 0.80
R6338:Frmpd1 UTSW 4 45274489 missense probably benign 0.00
R6544:Frmpd1 UTSW 4 45279024 missense probably damaging 1.00
R6728:Frmpd1 UTSW 4 45284664 missense probably benign
R6748:Frmpd1 UTSW 4 45274397 missense probably benign 0.08
R6798:Frmpd1 UTSW 4 45284850 missense probably benign 0.17
R6828:Frmpd1 UTSW 4 45275383 missense probably damaging 0.99
R7002:Frmpd1 UTSW 4 45284200 missense probably benign
R7258:Frmpd1 UTSW 4 45269974 missense possibly damaging 0.79
R7295:Frmpd1 UTSW 4 45285700 missense probably damaging 1.00
R7382:Frmpd1 UTSW 4 45278880 missense probably benign 0.00
R7423:Frmpd1 UTSW 4 45256948 missense probably damaging 1.00
R7451:Frmpd1 UTSW 4 45279558 missense probably benign 0.11
R7492:Frmpd1 UTSW 4 45285237 missense possibly damaging 0.71
R7524:Frmpd1 UTSW 4 45271181 missense probably benign 0.16
Z1088:Frmpd1 UTSW 4 45284080 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTTGGCCCACCAGGCTTCTCAAAG -3'
(R):5'- AGTATTCCTCATCTGAGCTGCCACC -3'

Sequencing Primer
(F):5'- AGGCTTCTCAAAGGGCCTC -3'
(R):5'- ATTCCAGCATGGAGCCAG -3'
Posted On2013-08-06