Mutagenetix > Incidental Mutation

Incidental Mutation 'R7924:Mtmr7'

643206

Institutional Source

Beutler Lab

Gene Symbol

Mtmr7

Ensembl Gene

ENSMUSG00000039431

Gene Name

myotubularin related protein 7

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7924 (G1)

Quality Score

999

Status

Validated

Chromosome

Chromosomal Location

40551095-40634797 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 40606884 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 62 (A62V)

Ref Sequence

ENSEMBL: ENSMUSP00000043851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048890] [ENSMUST00000048898] [ENSMUST00000173957] [ENSMUST00000174205]

AlphaFold

Q9Z2C9

Predicted Effect

probably benign
Transcript: ENSMUST00000048890
AA Change: A62V

PolyPhen 2 Score 0.359 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000043367
Gene: ENSMUSG00000039431
AA Change: A62V

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	108	450	4.9e-145	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048898
AA Change: A62V

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000043851
Gene: ENSMUSG00000039431
AA Change: A62V

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	109	448	1.6e-143	PFAM
coiled coil region	514	553	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173957
AA Change: A21V

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000134020
Gene: ENSMUSG00000039431
AA Change: A21V

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	67	260	4e-64	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174205
AA Change: A62V

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000134731
Gene: ENSMUSG00000039431
AA Change: A62V

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	108	450	7.2e-145	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myotubularin family of tyrosine/dual-specificity phosphatases. The encoded protein is characterized by four distinct domains that are conserved among all members of the myotubularin family: the glucosyltransferase, Rab-like GTPase activator and myotubularins domain, the Rac-induced recruitment domain, the protein tyrosine phosphatases and dual-specificity phosphatases domain and the suppressor of variegation 3-9, enhancer-of-zeste, and trithorax interaction domain. This protein dephosphorylates the target substrates phosphatidylinositol 3-phosphate and inositol 1,3-bisphosphate. A pseudogene of this gene is found on chromosome 5. [provided by RefSeq, Mar 2009]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022B05Rik	T	A	8: 124,663,312		probably benign	Het
4930435E12Rik	G	A	16: 38,812,464	Q369*	probably null	Het
Acacb	A	G	5: 114,245,220	K2155E	possibly damaging	Het
Adgre5	G	A	8: 83,729,400	P256S	possibly damaging	Het
Adipor1	T	A	1: 134,425,993	V172D	probably damaging	Het
Ahsa1	T	C	12: 87,270,456		probably null	Het
Ankrd11	T	C	8: 122,895,902	I404V	possibly damaging	Het
Asxl3	G	A	18: 22,525,545	R2204Q	probably damaging	Het
Barhl2	A	G	5: 106,457,649	S65P	unknown	Het
Bbx	A	T	16: 50,224,308	L630H	probably damaging	Het
Cars	T	C	7: 143,569,871	T531A	possibly damaging	Het
Catsperb	T	A	12: 101,520,565	H450Q	probably benign	Het
Cdt1	T	C	8: 122,569,352	L135P	probably damaging	Het
Cemip	A	T	7: 83,943,715		probably benign	Het
Cfap206	T	A	4: 34,728,833	H24L	probably benign	Het
Cnga4	T	A	7: 105,407,821	V480E	probably benign	Het
Cnot1	ACG	A	8: 95,745,647		probably null	Het
Ctcfl	G	A	2: 173,113,656	T271I	possibly damaging	Het
Dlc1	T	C	8: 36,571,416	R1003G	probably benign	Het
Dnah7b	A	G	1: 46,219,430	D1927G	probably benign	Het
Dscc1	A	T	15: 55,082,176	D374E	probably benign	Het
Eci2	G	A	13: 34,993,070	Q69*	probably null	Het
Ep300	C	A	15: 81,649,502	P1920Q	unknown	Het
Epha5	A	G	5: 84,084,846	Y629H	possibly damaging	Het
Fam208b	A	T	13: 3,594,331	F129Y	possibly damaging	Het
Fat2	G	A	11: 55,262,787	T3533I	probably benign	Het
Fat3	T	C	9: 15,999,297	N1803S	probably damaging	Het
Fcrls	T	C	3: 87,259,533	Y51C	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gcnt2	A	T	13: 40,918,564	K228*	probably null	Het
Gucy2c	A	T	6: 136,763,055	V258E	probably benign	Het
Hecw1	C	A	13: 14,322,528	L298F	probably damaging	Het
Hydin	T	G	8: 110,418,471	V818G	possibly damaging	Het
Hykk	A	G	9: 54,922,240	Y131C	probably damaging	Het
Ick	T	C	9: 78,155,464	L260P	probably damaging	Het
Mpo	A	G	11: 87,794,840	D48G	probably damaging	Het
Mrps10	T	C	17: 47,378,283	*202Q	probably null	Het
Mrps14	T	C	1: 160,196,989	V30A	probably benign	Het
Muc2	G	T	7: 141,695,388	G497W	probably damaging	Het
Nnt	A	T	13: 119,386,645	V237D	probably damaging	Het
Nox4	G	T	7: 87,374,381	V492L	probably benign	Het
Obscn	C	G	11: 59,112,555	E1306Q	probably benign	Het
Olfr303	A	G	7: 86,394,730	I256T	probably damaging	Het
Olfr993	T	C	2: 85,414,219	Y220C	probably benign	Het
Pard3	A	G	8: 127,410,750	N861S	probably benign	Het
Pdlim4	G	A	11: 54,055,222	R230*	probably null	Het
Pinlyp	C	T	7: 24,542,125	V159M	possibly damaging	Het
Pla2g4d	T	C	2: 120,289,164		probably benign	Het
Plcb1	A	T	2: 135,359,693	T855S	probably benign	Het
Pot1a	T	A	6: 25,753,310	D409V	possibly damaging	Het
Prom1	T	C	5: 44,029,769	D382G	probably benign	Het
Prss16	A	T	13: 22,008,664	N83K	probably damaging	Het
Ptprn2	A	G	12: 116,841,264	D133G	probably benign	Het
Rasef	C	T	4: 73,740,929		probably null	Het
Rbak	A	G	5: 143,174,486	S271P	probably damaging	Het
Rbm20	A	T	19: 53,677,585	I60F	possibly damaging	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rsf1	G	GACGGCCGCC	7: 97,579,909		probably benign	Het
Serpinb3c	A	G	1: 107,273,174	L171P	probably damaging	Het
Slc25a19	T	C	11: 115,615,550	Y211C	unknown	Het
Sorbs2	C	T	8: 45,795,470	S586L	probably damaging	Het
Spesp1	A	T	9: 62,273,451	S58R	probably benign	Het
Spryd3	A	G	15: 102,118,327	I329T	probably benign	Het
St8sia2	G	A	7: 73,966,952	L113F	probably damaging	Het
Star	T	C	8: 25,809,855	I75T	possibly damaging	Het
Tdrd6	T	A	17: 43,627,806	I784F	possibly damaging	Het
Tsc22d4	A	G	5: 137,768,011	I144V	unknown	Het
Tspan8	T	C	10: 115,833,324		probably null	Het
Ttll9	C	T	2: 152,962,487		probably benign	Het
Ttn	T	C	2: 76,809,850		probably benign	Het
Ubr4	T	G	4: 139,467,276	L1160R	unknown	Het
Ufd1	A	G	16: 18,823,285	Y162C	possibly damaging	Het
Unc13c	A	T	9: 73,734,408	F1268I	probably benign	Het
Uvssa	T	C	5: 33,410,951	I561T	probably damaging	Het
Vmn2r15	A	T	5: 109,286,388	S817T	probably damaging	Het
Ybx1	T	C	4: 119,282,279	E173G	probably damaging	Het
Zc3h6	T	C	2: 129,015,480	S640P	possibly damaging	Het

Other mutations in Mtmr7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Mtmr7	APN	8	40597345	missense	probably damaging	1.00
IGL01340:Mtmr7	APN	8	40597422	missense	probably damaging	1.00
IGL01773:Mtmr7	APN	8	40581419	missense	probably damaging	1.00
IGL02040:Mtmr7	APN	8	40560885	missense	probably benign	0.01
IGL02195:Mtmr7	APN	8	40560905	missense	probably damaging	0.96
IGL03394:Mtmr7	APN	8	40608929	missense	probably damaging	0.97
BB001:Mtmr7	UTSW	8	40606884	missense	possibly damaging	0.62
BB003:Mtmr7	UTSW	8	40606884	missense	possibly damaging	0.62
BB011:Mtmr7	UTSW	8	40606884	missense	possibly damaging	0.62
BB013:Mtmr7	UTSW	8	40606884	missense	possibly damaging	0.62
R0116:Mtmr7	UTSW	8	40581405	splice site	probably benign
R0379:Mtmr7	UTSW	8	40551601	missense	probably damaging	1.00
R1443:Mtmr7	UTSW	8	40560882	missense	probably damaging	1.00
R1763:Mtmr7	UTSW	8	40551811	missense	probably benign
R4372:Mtmr7	UTSW	8	40554345	missense	probably damaging	1.00
R4482:Mtmr7	UTSW	8	40554384	missense	probably benign	0.32
R4502:Mtmr7	UTSW	8	40558162	missense	possibly damaging	0.94
R4622:Mtmr7	UTSW	8	40581541	missense	probably damaging	1.00
R4833:Mtmr7	UTSW	8	40590462	missense	probably damaging	1.00
R4849:Mtmr7	UTSW	8	40608997	missense	probably benign	0.00
R4991:Mtmr7	UTSW	8	40554345	missense	probably damaging	1.00
R5424:Mtmr7	UTSW	8	40606830	missense	probably benign
R5707:Mtmr7	UTSW	8	40558162	missense	possibly damaging	0.94
R5929:Mtmr7	UTSW	8	40558358	critical splice acceptor site	probably null
R5985:Mtmr7	UTSW	8	40551832	missense	probably benign
R6013:Mtmr7	UTSW	8	40581528	missense	probably damaging	1.00
R6249:Mtmr7	UTSW	8	40581482	missense	probably damaging	1.00
R7052:Mtmr7	UTSW	8	40555833	missense	possibly damaging	0.83
R7249:Mtmr7	UTSW	8	40590477	missense	probably benign	0.11
R7538:Mtmr7	UTSW	8	40597384	missense	probably damaging	1.00
R7698:Mtmr7	UTSW	8	40606884	missense	possibly damaging	0.62
R7699:Mtmr7	UTSW	8	40606884	missense	possibly damaging	0.62
R7699:Mtmr7	UTSW	8	40606884	missense	possibly damaging	0.62
R7700:Mtmr7	UTSW	8	40606884	missense	possibly damaging	0.62
R7708:Mtmr7	UTSW	8	40590511	missense	probably damaging	0.98
R7890:Mtmr7	UTSW	8	40551735	missense	possibly damaging	0.91
R7926:Mtmr7	UTSW	8	40606884	missense	possibly damaging	0.62
R8059:Mtmr7	UTSW	8	40581522	missense	probably damaging	1.00
R8446:Mtmr7	UTSW	8	40606884	missense	possibly damaging	0.62
R8493:Mtmr7	UTSW	8	40606884	missense	possibly damaging	0.62
R9009:Mtmr7	UTSW	8	40555863	missense	possibly damaging	0.92
R9527:Mtmr7	UTSW	8	40558304	missense	possibly damaging	0.74
Z1177:Mtmr7	UTSW	8	40597379	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CACTGCTATTCCTAAGCATAACAGG -3'
(R):5'- ACCCTCCAGCTCTTGTAAGC -3'

Sequencing Primer
(F):5'- AACCCTGCCACGTGACTTG -3'
(R):5'- CTCCAGCTCTTGTAAGCAGAGTG -3'

Posted On

2020-08-07