Incidental Mutation 'R7924:Prss16'
ID 643231
Institutional Source Beutler Lab
Gene Symbol Prss16
Ensembl Gene ENSMUSG00000006179
Gene Name protease, serine 16 (thymus)
Synonyms TSSP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7924 (G1)
Quality Score 999
Status Validated
Chromosome 13
Chromosomal Location 22002173-22009742 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 22008664 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 83 (N83K)
Ref Sequence ENSEMBL: ENSMUSP00000006341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006341] [ENSMUST00000150547]
AlphaFold Q9QXE5
Predicted Effect probably damaging
Transcript: ENSMUST00000006341
AA Change: N83K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006341
Gene: ENSMUSG00000006179
AA Change: N83K

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 40 53 N/A INTRINSIC
Pfam:Peptidase_S28 63 493 1.9e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150547
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine protease expressed exclusively in the thymus. It is thought to play a role in the alternative antigen presenting pathway used by cortical thymic epithelial cells during the positive selection of T cells. The gene is found in the large histone gene cluster on chromosome 6, near the major histocompatibility complex (MHC) class I region. A second transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable with no gross abnormalities and normal T cell development and activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T A 8: 124,663,312 probably benign Het
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cemip A T 7: 83,943,715 probably benign Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Pla2g4d T C 2: 120,289,164 probably benign Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rsf1 G GACGGCCGCC 7: 97,579,909 probably benign Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ttn T C 2: 76,809,850 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Prss16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Prss16 APN 13 22003021 missense probably damaging 0.99
IGL02272:Prss16 APN 13 22003035 missense probably damaging 0.96
IGL02383:Prss16 APN 13 22009527 missense probably benign 0.00
IGL02892:Prss16 APN 13 22003050 missense probably benign 0.03
IGL03325:Prss16 APN 13 22003247 missense possibly damaging 0.90
BB001:Prss16 UTSW 13 22008664 missense probably damaging 0.99
BB011:Prss16 UTSW 13 22008664 missense probably damaging 0.99
R0645:Prss16 UTSW 13 22009376 unclassified probably benign
R0970:Prss16 UTSW 13 22005117 missense probably damaging 1.00
R1146:Prss16 UTSW 13 22006968 unclassified probably benign
R1292:Prss16 UTSW 13 22009521 nonsense probably null
R1371:Prss16 UTSW 13 22008686 unclassified probably benign
R1525:Prss16 UTSW 13 22009443 missense possibly damaging 0.50
R1624:Prss16 UTSW 13 22003313 missense probably benign 0.31
R2233:Prss16 UTSW 13 22009409 missense possibly damaging 0.70
R5147:Prss16 UTSW 13 22006094 missense possibly damaging 0.70
R5670:Prss16 UTSW 13 22003051 missense possibly damaging 0.74
R6440:Prss16 UTSW 13 22003160 missense probably damaging 0.97
R6668:Prss16 UTSW 13 22006748 missense probably null 0.01
R6791:Prss16 UTSW 13 22006067 missense probably damaging 0.99
R7278:Prss16 UTSW 13 22003147 missense probably damaging 1.00
R8865:Prss16 UTSW 13 22003005 missense possibly damaging 0.71
R8980:Prss16 UTSW 13 22003042 missense probably benign 0.13
R9139:Prss16 UTSW 13 22008343 missense probably damaging 1.00
R9211:Prss16 UTSW 13 22008584 missense probably benign 0.19
R9276:Prss16 UTSW 13 22006005 start gained probably benign
R9318:Prss16 UTSW 13 22006938 missense possibly damaging 0.95
R9748:Prss16 UTSW 13 22008334 missense possibly damaging 0.88
Z1176:Prss16 UTSW 13 22006054 nonsense probably null
Z1176:Prss16 UTSW 13 22006400 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCTAGGCTTATCACCAGGGC -3'
(R):5'- TCCAGGGCCTCTAATGTCTACC -3'

Sequencing Primer
(F):5'- CCTGTGGAGAGCGCATGGTAG -3'
(R):5'- AGGGCCTCTAATGTCTACCTTTATAG -3'
Posted On 2020-08-07