Mutagenetix > Incidental Mutations

Ensembl: ENSMUST00000019400

Incidental Mutation 'R8342:Ahr'

644970

Institutional Source

Beutler Lab

Gene Symbol

Ahr

Ensembl Gene

ENSMUSG00000019256

Gene Name

aryl-hydrocarbon receptor

Synonyms

bHLHe76, In, dioxin receptor, Ah, Ahh, Ahre

MMRRC Submission

Accession Numbers

Genbank: NM_013464; MGI: 105043;

Is this an essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R8342 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

35497974-35535038 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 35508272 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 250 (G250R)

Ref Sequence

ENSEMBL: ENSMUSP00000112137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110811] [ENSMUST00000116436]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110811

SMART Domains

Protein: ENSMUSP00000106434
Gene: ENSMUSG00000019256

Domain	Start	End	E-Value	Type
HLH	33	87	3.31e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000116436
AA Change: G250R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112137
Gene: ENSMUSG00000019256
AA Change: G250R

Domain	Start	End	E-Value	Type
HLH	33	87	5.09e-7	SMART
PAS	111	177	2.72e-12	SMART
low complexity region	212	222	N/A	INTRINSIC
PAS	266	336	1.77e-2	SMART
PAC	342	383	2.39e-8	SMART
low complexity region	606	640	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for null or hypomorphic alleles do not respond to cyclic compounds (e.g., dioxin) and are resistant to their teratogenic effects. Depending on the allele, null mutants may also have liver defects, impaired female fertility, neonatal or postnatal lethality, and spleen abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(6) Other(4)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931423N10Rik	T	A	2: 23,257,005		probably null	Het
Aak1	A	G	6: 86,986,339	D917G	unknown	Het
Adad1	T	C	3: 37,079,901	S322P	probably damaging	Het
Agbl4	C	T	4: 111,119,027	L194F	probably damaging	Het
AI987944	A	T	7: 41,374,886	I226N	probably benign	Het
Ankar	A	G	1: 72,652,460	V1114A	probably damaging	Het
Ankrd49	C	A	9: 14,781,527	A114S	probably damaging	Het
Arl6	C	T	16: 59,622,439	G140D	unknown	Het
Arrdc3	A	G	13: 80,883,671	S8G	probably benign	Het
Ate1	A	T	7: 130,503,765	V298E	probably benign	Het
Atp6v1b2	A	G	8: 69,101,383	I71V	probably benign	Het
Bin1	A	G	18: 32,413,113	M112V	probably benign	Het
Camk2b	C	T	11: 5,990,383	A152T	probably benign	Het
Cars2	A	C	8: 11,529,706	F251V	probably damaging	Het
Cdkl1	A	T	12: 69,754,178	F229I	probably damaging	Het
Ceacam5	A	T	7: 17,752,246	Y556F	possibly damaging	Het
Chst15	T	C	7: 132,247,886	N442S	probably benign	Het
Ckap5	T	A	2: 91,606,362	D1602E	possibly damaging	Het
Col9a3	A	T	2: 180,603,390	I131F	unknown	Het
Cyp4f15	A	T	17: 32,690,759	D110V	possibly damaging	Het
Dlec1	A	G	9: 119,139,389	I1258V	probably benign	Het
Dpyd	A	G	3: 119,314,803	T832A	possibly damaging	Het
Eno1	A	G	4: 150,245,236	Y189C	probably damaging	Het
Gm12800	A	T	4: 101,910,384	M277L	probably benign	Het
Gnat3	A	G	5: 18,003,840	T181A		Het
Kif1b	T	C	4: 149,222,348	M852V	probably damaging	Het
Klk1b26	A	T	7: 44,016,084	I139F	probably damaging	Het
Loxhd1	G	A	18: 77,405,985	V1547M	possibly damaging	Het
Lrp4	A	G	2: 91,488,445	T876A	probably damaging	Het
Malrd1	G	T	2: 15,633,224	W451L	unknown	Het
March6	A	T	15: 31,494,116	N261K	possibly damaging	Het
Mcpt2	T	C	14: 56,042,793	C50R	probably damaging	Het
Muc16	A	G	9: 18,658,685	V846A	unknown	Het
Muc5b	A	T	7: 141,860,865	D2516V	unknown	Het
Myh15	T	C	16: 49,092,757	L359P	probably benign	Het
Nemp1	G	A	10: 127,693,029	V201I	probably benign	Het
Nr2e1	A	T	10: 42,568,429	L228Q	probably damaging	Het
Nrg1	C	A	8: 31,822,306	V388L	probably benign	Het
Nrg3	T	A	14: 39,012,096	T278S	probably damaging	Het
Numb	T	C	12: 83,808,216	E112G	probably benign	Het
Olfr364-ps1	T	C	2: 37,146,766	S185P	probably damaging	Het
Olfr971	A	C	9: 39,840,316	N294T	probably damaging	Het
Pdlim2	C	A	14: 70,166,114	C283F	probably damaging	Het
Ppm1a	G	A	12: 72,784,135	G145R	probably damaging	Het
Pramef17	T	A	4: 143,994,239	D44V	probably benign	Het
Prune2	C	A	19: 17,125,663	Q2729K	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Scn9a	G	T	2: 66,536,282	T719K	probably benign	Het
Slc12a7	T	C	13: 73,785,162	V113A	probably benign	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc37a2	A	T	9: 37,238,214		probably null	Het
Steap1	G	A	5: 5,740,816	S44L	probably benign	Het
Sucnr1	C	T	3: 60,086,734	R228C	probably damaging	Het
Sult3a1	G	A	10: 33,866,521	G48D	probably damaging	Het
Syn3	A	T	10: 86,467,027	V88D	probably damaging	Het
Syne1	T	C	10: 5,108,622	D7297G	probably benign	Het
Tmco5	T	C	2: 116,880,253	I18T	probably damaging	Het
Trpc1	A	G	9: 95,726,548	L230P	probably damaging	Het
Ttn	T	C	2: 76,889,441	N7108S	unknown	Het
Ubr5	A	G	15: 38,024,837	V559A		Het
Ugt1a7c	T	C	1: 88,095,251	V44A	possibly damaging	Het
Vmn2r60	A	T	7: 42,141,070	S494C	possibly damaging	Het

Other mutations in Ahr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00589:Ahr	APN	12	35504097	nonsense	probably null
IGL01336:Ahr	APN	12	35503840	missense	probably benign	0.19
IGL01972:Ahr	APN	12	35504449	missense	possibly damaging	0.89
IGL02117:Ahr	APN	12	35512923	nonsense	probably null
IGL03028:Ahr	APN	12	35504710	missense	probably benign
IGL03110:Ahr	APN	12	35504971	missense	probably damaging	0.98
IGL03394:Ahr	APN	12	35503752	nonsense	probably null
IGL03403:Ahr	APN	12	35504326	missense	possibly damaging	0.63
BB002:Ahr	UTSW	12	35515068	nonsense	probably null
BB012:Ahr	UTSW	12	35515068	nonsense	probably null
R0620:Ahr	UTSW	12	35508194	missense	probably benign	0.26
R0784:Ahr	UTSW	12	35508142	missense	possibly damaging	0.79
R1133:Ahr	UTSW	12	35526806	missense	probably damaging	1.00
R1168:Ahr	UTSW	12	35504532	missense	possibly damaging	0.49
R4678:Ahr	UTSW	12	35507464	missense	probably damaging	1.00
R5615:Ahr	UTSW	12	35503885	missense	probably benign	0.01
R6066:Ahr	UTSW	12	35504921	missense	probably damaging	0.99
R6466:Ahr	UTSW	12	35504032	missense	probably benign	0.29
R7369:Ahr	UTSW	12	35504660	missense	possibly damaging	0.94
R7382:Ahr	UTSW	12	35504515	missense	probably damaging	1.00
R7685:Ahr	UTSW	12	35504017	missense	probably damaging	0.96
R7819:Ahr	UTSW	12	35510000	missense	probably damaging	1.00
R7897:Ahr	UTSW	12	35504170	missense	possibly damaging	0.47
R7925:Ahr	UTSW	12	35515068	nonsense	probably null
R8179:Ahr	UTSW	12	35510051	missense	probably benign	0.01
R8274:Ahr	UTSW	12	35510069	missense	probably benign
R8985:Ahr	UTSW	12	35526737	missense	possibly damaging	0.91
R9114:Ahr	UTSW	12	35511165	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACCCTATAGTAGTAACATTAGAACC -3'
(R):5'- CAGGGTAGGTCACTTGGCAG -3'

Sequencing Primer
(F):5'- ATCTCACACACTTACAAATCTGC -3'
(R):5'- GAAATTAAGTTAGTGGTTCTGAGCC -3'

Posted On

2020-09-02