Ensembl:   ENSMUST00000019400 

Incidental Mutation 'R8342:Ahr'
ID 644970
Institutional Source Beutler Lab
Gene Symbol Ahr
Ensembl Gene ENSMUSG00000019256
Gene Name aryl-hydrocarbon receptor
Synonyms bHLHe76, In, dioxin receptor, Ah, Ahh, Ahre
MMRRC Submission
Accession Numbers

Genbank: NM_013464; MGI: 105043

  
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock # R8342 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 35497974-35535038 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 35508272 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 250 (G250R)
Ref Sequence ENSEMBL: ENSMUSP00000112137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110811] [ENSMUST00000116436]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110811
SMART Domains Protein: ENSMUSP00000106434
Gene: ENSMUSG00000019256

DomainStartEndE-ValueType
HLH 33 87 3.31e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116436
AA Change: G250R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112137
Gene: ENSMUSG00000019256
AA Change: G250R

DomainStartEndE-ValueType
HLH 33 87 5.09e-7 SMART
PAS 111 177 2.72e-12 SMART
low complexity region 212 222 N/A INTRINSIC
PAS 266 336 1.77e-2 SMART
PAC 342 383 2.39e-8 SMART
low complexity region 606 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for null or hypomorphic alleles do not respond to cyclic compounds (e.g., dioxin) and are resistant to their teratogenic effects. Depending on the allele, null mutants may also have liver defects, impaired female fertility, neonatal or postnatal lethality, and spleen abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(6) Other(4)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,257,005 probably null Het
Aak1 A G 6: 86,986,339 D917G unknown Het
Adad1 T C 3: 37,079,901 S322P probably damaging Het
Agbl4 C T 4: 111,119,027 L194F probably damaging Het
AI987944 A T 7: 41,374,886 I226N probably benign Het
Ankar A G 1: 72,652,460 V1114A probably damaging Het
Ankrd49 C A 9: 14,781,527 A114S probably damaging Het
Arl6 C T 16: 59,622,439 G140D unknown Het
Arrdc3 A G 13: 80,883,671 S8G probably benign Het
Ate1 A T 7: 130,503,765 V298E probably benign Het
Atp6v1b2 A G 8: 69,101,383 I71V probably benign Het
Bin1 A G 18: 32,413,113 M112V probably benign Het
Camk2b C T 11: 5,990,383 A152T probably benign Het
Cars2 A C 8: 11,529,706 F251V probably damaging Het
Cdkl1 A T 12: 69,754,178 F229I probably damaging Het
Ceacam5 A T 7: 17,752,246 Y556F possibly damaging Het
Chst15 T C 7: 132,247,886 N442S probably benign Het
Ckap5 T A 2: 91,606,362 D1602E possibly damaging Het
Col9a3 A T 2: 180,603,390 I131F unknown Het
Cyp4f15 A T 17: 32,690,759 D110V possibly damaging Het
Dlec1 A G 9: 119,139,389 I1258V probably benign Het
Dpyd A G 3: 119,314,803 T832A possibly damaging Het
Eno1 A G 4: 150,245,236 Y189C probably damaging Het
Gm12800 A T 4: 101,910,384 M277L probably benign Het
Gnat3 A G 5: 18,003,840 T181A Het
Kif1b T C 4: 149,222,348 M852V probably damaging Het
Klk1b26 A T 7: 44,016,084 I139F probably damaging Het
Loxhd1 G A 18: 77,405,985 V1547M possibly damaging Het
Lrp4 A G 2: 91,488,445 T876A probably damaging Het
Malrd1 G T 2: 15,633,224 W451L unknown Het
March6 A T 15: 31,494,116 N261K possibly damaging Het
Mcpt2 T C 14: 56,042,793 C50R probably damaging Het
Muc16 A G 9: 18,658,685 V846A unknown Het
Muc5b A T 7: 141,860,865 D2516V unknown Het
Myh15 T C 16: 49,092,757 L359P probably benign Het
Nemp1 G A 10: 127,693,029 V201I probably benign Het
Nr2e1 A T 10: 42,568,429 L228Q probably damaging Het
Nrg1 C A 8: 31,822,306 V388L probably benign Het
Nrg3 T A 14: 39,012,096 T278S probably damaging Het
Numb T C 12: 83,808,216 E112G probably benign Het
Olfr364-ps1 T C 2: 37,146,766 S185P probably damaging Het
Olfr971 A C 9: 39,840,316 N294T probably damaging Het
Pdlim2 C A 14: 70,166,114 C283F probably damaging Het
Ppm1a G A 12: 72,784,135 G145R probably damaging Het
Pramef17 T A 4: 143,994,239 D44V probably benign Het
Prune2 C A 19: 17,125,663 Q2729K probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn9a G T 2: 66,536,282 T719K probably benign Het
Slc12a7 T C 13: 73,785,162 V113A probably benign Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc37a2 A T 9: 37,238,214 probably null Het
Steap1 G A 5: 5,740,816 S44L probably benign Het
Sucnr1 C T 3: 60,086,734 R228C probably damaging Het
Sult3a1 G A 10: 33,866,521 G48D probably damaging Het
Syn3 A T 10: 86,467,027 V88D probably damaging Het
Syne1 T C 10: 5,108,622 D7297G probably benign Het
Tmco5 T C 2: 116,880,253 I18T probably damaging Het
Trpc1 A G 9: 95,726,548 L230P probably damaging Het
Ttn T C 2: 76,889,441 N7108S unknown Het
Ubr5 A G 15: 38,024,837 V559A Het
Ugt1a7c T C 1: 88,095,251 V44A possibly damaging Het
Vmn2r60 A T 7: 42,141,070 S494C possibly damaging Het
Other mutations in Ahr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Ahr APN 12 35504097 nonsense probably null
IGL01336:Ahr APN 12 35503840 missense probably benign 0.19
IGL01972:Ahr APN 12 35504449 missense possibly damaging 0.89
IGL02117:Ahr APN 12 35512923 nonsense probably null
IGL03028:Ahr APN 12 35504710 missense probably benign
IGL03110:Ahr APN 12 35504971 missense probably damaging 0.98
IGL03394:Ahr APN 12 35503752 nonsense probably null
IGL03403:Ahr APN 12 35504326 missense possibly damaging 0.63
BB002:Ahr UTSW 12 35515068 nonsense probably null
BB012:Ahr UTSW 12 35515068 nonsense probably null
R0620:Ahr UTSW 12 35508194 missense probably benign 0.26
R0784:Ahr UTSW 12 35508142 missense possibly damaging 0.79
R1133:Ahr UTSW 12 35526806 missense probably damaging 1.00
R1168:Ahr UTSW 12 35504532 missense possibly damaging 0.49
R4678:Ahr UTSW 12 35507464 missense probably damaging 1.00
R5615:Ahr UTSW 12 35503885 missense probably benign 0.01
R6066:Ahr UTSW 12 35504921 missense probably damaging 0.99
R6466:Ahr UTSW 12 35504032 missense probably benign 0.29
R7369:Ahr UTSW 12 35504660 missense possibly damaging 0.94
R7382:Ahr UTSW 12 35504515 missense probably damaging 1.00
R7685:Ahr UTSW 12 35504017 missense probably damaging 0.96
R7819:Ahr UTSW 12 35510000 missense probably damaging 1.00
R7897:Ahr UTSW 12 35504170 missense possibly damaging 0.47
R7925:Ahr UTSW 12 35515068 nonsense probably null
R8179:Ahr UTSW 12 35510051 missense probably benign 0.01
R8274:Ahr UTSW 12 35510069 missense probably benign
R8985:Ahr UTSW 12 35526737 missense possibly damaging 0.91
R9114:Ahr UTSW 12 35511165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCCTATAGTAGTAACATTAGAACC -3'
(R):5'- CAGGGTAGGTCACTTGGCAG -3'

Sequencing Primer
(F):5'- ATCTCACACACTTACAAATCTGC -3'
(R):5'- GAAATTAAGTTAGTGGTTCTGAGCC -3'
Posted On 2020-09-02