Incidental Mutation 'R6066:Ahr'
ID 484049
Institutional Source Beutler Lab
Gene Symbol Ahr
Ensembl Gene ENSMUSG00000019256
Gene Name aryl-hydrocarbon receptor
Synonyms In, bHLHe76, dioxin receptor, Ah, Ahh, Ahre
MMRRC Submission 044230-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.954) question?
Stock # R6066 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 35547978-35584988 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 35554920 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 400 (F400I)
Ref Sequence ENSEMBL: ENSMUSP00000112137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110811] [ENSMUST00000116436]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110811
SMART Domains Protein: ENSMUSP00000106434
Gene: ENSMUSG00000019256

DomainStartEndE-ValueType
HLH 33 87 3.31e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116436
AA Change: F400I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112137
Gene: ENSMUSG00000019256
AA Change: F400I

DomainStartEndE-ValueType
HLH 33 87 5.09e-7 SMART
PAS 111 177 2.72e-12 SMART
low complexity region 212 222 N/A INTRINSIC
PAS 266 336 1.77e-2 SMART
PAC 342 383 2.39e-8 SMART
low complexity region 606 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for null or hypomorphic alleles do not respond to cyclic compounds (e.g., dioxin) and are resistant to their teratogenic effects. Depending on the allele, null mutants may also have liver defects, impaired female fertility, neonatal or postnatal lethality, and spleen abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(6) Other(4)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgrb1 T C 15: 74,412,308 (GRCm39) F429S probably damaging Het
Ahi1 A T 10: 20,835,825 (GRCm39) M53L possibly damaging Het
Ak7 G T 12: 105,699,750 (GRCm39) G223V possibly damaging Het
Alpk3 A G 7: 80,726,698 (GRCm39) I128V possibly damaging Het
Ampd3 A T 7: 110,392,974 (GRCm39) E247D probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 64,922,910 (GRCm39) probably null Het
Arhgef10l A G 4: 140,304,391 (GRCm39) F243L probably damaging Het
Cdh23 A T 10: 60,269,537 (GRCm39) V661E probably damaging Het
Cox8c A G 12: 102,866,534 (GRCm39) T53A probably benign Het
Creld2 C A 15: 88,707,969 (GRCm39) T236K possibly damaging Het
Cul3 A T 1: 80,261,476 (GRCm39) C250S probably benign Het
Dhx37 A C 5: 125,501,730 (GRCm39) F510V probably benign Het
Fblim1 T C 4: 141,305,220 (GRCm39) D350G probably damaging Het
Lipm A G 19: 34,090,374 (GRCm39) Y185C probably damaging Het
Mfsd4b4 A G 10: 39,768,049 (GRCm39) F348S probably benign Het
Misp A G 10: 79,662,146 (GRCm39) R188G possibly damaging Het
Nbeal1 T G 1: 60,287,564 (GRCm39) I936S probably benign Het
Ngly1 G A 14: 16,294,634 (GRCm38) M521I probably benign Het
Nlrp9a A T 7: 26,257,510 (GRCm39) Y376F probably benign Het
Oas3 T C 5: 120,910,989 (GRCm39) K197R probably damaging Het
Pars2 T C 4: 106,511,276 (GRCm39) Y353H probably damaging Het
Pik3r1 T C 13: 101,822,828 (GRCm39) N625D possibly damaging Het
Pkhd1l1 T A 15: 44,391,525 (GRCm39) S1530R probably damaging Het
Rsph6a C T 7: 18,799,740 (GRCm39) P457L probably damaging Het
Secisbp2 T C 13: 51,831,258 (GRCm39) S565P probably benign Het
Slc28a3 T C 13: 58,726,301 (GRCm39) M163V probably benign Het
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Svil T G 18: 5,106,724 (GRCm39) V1855G probably damaging Het
Szt2 T C 4: 118,229,171 (GRCm39) T2890A unknown Het
Tatdn3 A T 1: 190,778,465 (GRCm39) V242E probably benign Het
Vmn1r22 T G 6: 57,877,864 (GRCm39) M38L probably benign Het
Vmn2r104 A G 17: 20,258,573 (GRCm39) F524L possibly damaging Het
Vmn2r94 A G 17: 18,477,695 (GRCm39) S239P probably damaging Het
Xpo7 T C 14: 70,919,778 (GRCm39) D679G probably null Het
Zbtb42 C A 12: 112,646,041 (GRCm39) T72K probably damaging Het
Zfp493 G A 13: 67,935,069 (GRCm39) A341T possibly damaging Het
Zfp811 A G 17: 33,017,801 (GRCm39) C80R possibly damaging Het
Other mutations in Ahr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Ahr APN 12 35,554,096 (GRCm39) nonsense probably null
IGL01336:Ahr APN 12 35,553,839 (GRCm39) missense probably benign 0.19
IGL01972:Ahr APN 12 35,554,448 (GRCm39) missense possibly damaging 0.89
IGL02117:Ahr APN 12 35,562,922 (GRCm39) nonsense probably null
IGL03028:Ahr APN 12 35,554,709 (GRCm39) missense probably benign
IGL03110:Ahr APN 12 35,554,970 (GRCm39) missense probably damaging 0.98
IGL03394:Ahr APN 12 35,553,751 (GRCm39) nonsense probably null
IGL03403:Ahr APN 12 35,554,325 (GRCm39) missense possibly damaging 0.63
BB002:Ahr UTSW 12 35,565,067 (GRCm39) nonsense probably null
BB012:Ahr UTSW 12 35,565,067 (GRCm39) nonsense probably null
R0620:Ahr UTSW 12 35,558,193 (GRCm39) missense probably benign 0.26
R0784:Ahr UTSW 12 35,558,141 (GRCm39) missense possibly damaging 0.79
R1133:Ahr UTSW 12 35,576,805 (GRCm39) missense probably damaging 1.00
R1168:Ahr UTSW 12 35,554,531 (GRCm39) missense possibly damaging 0.49
R4678:Ahr UTSW 12 35,557,463 (GRCm39) missense probably damaging 1.00
R5615:Ahr UTSW 12 35,553,884 (GRCm39) missense probably benign 0.01
R6466:Ahr UTSW 12 35,554,031 (GRCm39) missense probably benign 0.29
R7369:Ahr UTSW 12 35,554,659 (GRCm39) missense possibly damaging 0.94
R7382:Ahr UTSW 12 35,554,514 (GRCm39) missense probably damaging 1.00
R7685:Ahr UTSW 12 35,554,016 (GRCm39) missense probably damaging 0.96
R7819:Ahr UTSW 12 35,559,999 (GRCm39) missense probably damaging 1.00
R7897:Ahr UTSW 12 35,554,169 (GRCm39) missense possibly damaging 0.47
R7925:Ahr UTSW 12 35,565,067 (GRCm39) nonsense probably null
R8179:Ahr UTSW 12 35,560,050 (GRCm39) missense probably benign 0.01
R8274:Ahr UTSW 12 35,560,068 (GRCm39) missense probably benign
R8342:Ahr UTSW 12 35,558,271 (GRCm39) missense probably damaging 1.00
R8985:Ahr UTSW 12 35,576,736 (GRCm39) missense possibly damaging 0.91
R9069:Ahr UTSW 12 35,562,771 (GRCm39) intron probably benign
R9114:Ahr UTSW 12 35,561,164 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCATGAGAAAATGGCTGTC -3'
(R):5'- AAATCCATGTTCCTTGCTATCAAGC -3'

Sequencing Primer
(F):5'- CCCATGAGAAAATGGCTGTCTAACAG -3'
(R):5'- AGCTCAGCTTTAGTGCGTTTTAC -3'
Posted On 2017-07-14