Incidental Mutation 'R7975:Pappa'
ID650832
Institutional Source Beutler Lab
Gene Symbol Pappa
Ensembl Gene ENSMUSG00000028370
Gene Namepregnancy-associated plasma protein A
SynonymsIGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R7975 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location65124174-65357509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65294468 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1121 (D1121V)
Ref Sequence ENSEMBL: ENSMUSP00000081545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084501]
Predicted Effect probably damaging
Transcript: ENSMUST00000084501
AA Change: D1121V

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: D1121V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C T 10: 82,283,989 A4396T possibly damaging Het
Ano4 T C 10: 89,116,985 I60V possibly damaging Het
Ano5 T A 7: 51,566,538 M381K probably null Het
Aox2 T A 1: 58,309,028 I635K probably benign Het
BC067074 A G 13: 113,319,307 H629R Het
Bdp1 C T 13: 100,020,376 C2436Y probably benign Het
Bod1l T C 5: 41,816,277 R2565G possibly damaging Het
Brd2 A T 17: 34,115,450 I245N probably damaging Het
Capn9 G A 8: 124,598,776 V258M probably damaging Het
Ccar2 C G 14: 70,143,469 C324S possibly damaging Het
Cd209b A T 8: 3,925,948 I71N probably benign Het
Cdk12 A T 11: 98,221,102 I729F unknown Het
Celf1 T G 2: 91,001,078 V84G probably damaging Het
Cgn G T 3: 94,764,529 A965E probably benign Het
Cgnl1 T C 9: 71,725,322 E249G probably benign Het
Cyp2j8 T C 4: 96,470,539 N381S possibly damaging Het
Dmtf1 T C 5: 9,129,169 D343G probably damaging Het
Fhl5 T A 4: 25,214,730 I16F probably benign Het
Gatd1 A G 7: 141,409,868 F143S probably damaging Het
Gbp10 C T 5: 105,221,101 G291R probably benign Het
Gm28168 T C 1: 117,948,090 Y150H probably benign Het
Gm3543 T C 14: 41,980,165 M121V probably benign Het
Gramd3 A G 18: 56,485,379 T220A probably benign Het
Gstcd A G 3: 133,072,102 L316P probably damaging Het
Hspg2 G A 4: 137,555,221 G3424D probably benign Het
Ifi209 C T 1: 173,641,156 S184F probably benign Het
Kcnd3 G A 3: 105,458,994 R60H probably damaging Het
Kif21b T C 1: 136,171,173 C1400R probably damaging Het
Lama3 C T 18: 12,537,739 P794L probably damaging Het
Lgals4 A G 7: 28,840,921 I214V probably benign Het
Lipo4 A T 19: 33,512,628 L158Q probably damaging Het
Ltv1 A G 10: 13,190,709 Y58H probably damaging Het
Mitf T C 6: 98,018,029 S479P probably benign Het
Mthfr A T 4: 148,043,463 D132V probably damaging Het
Neb T A 2: 52,160,666 H6660L probably benign Het
Nhlrc3 A T 3: 53,453,545 V263E probably damaging Het
Oas1h G A 5: 120,871,827 V322M probably damaging Het
Olfr1234 C T 2: 89,363,069 R120H probably benign Het
Olfr165 T A 16: 19,407,551 D155V probably damaging Het
Olfr519 A T 7: 108,893,812 Y203* probably null Het
Pax5 A G 4: 44,537,465 S352P probably damaging Het
Piezo1 C A 8: 122,495,765 R915L Het
R3hcc1 T C 14: 69,707,144 D7G probably damaging Het
Rasgrp2 A G 19: 6,408,559 K429E probably damaging Het
Scn10a A G 9: 119,672,220 F166S probably benign Het
Scn9a T G 2: 66,484,253 N1707T probably damaging Het
Sec23ip T C 7: 128,762,477 F493S probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slfn4 A T 11: 83,187,156 I257F possibly damaging Het
Smarcal1 T A 1: 72,612,991 D637E probably benign Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sos2 A T 12: 69,593,040 F990L probably benign Het
Syne1 T C 10: 5,031,786 T844A probably benign Het
Tph1 G A 7: 46,657,254 R145C probably damaging Het
Vmn2r50 T C 7: 10,037,345 I810V probably benign Het
Vmn2r59 T C 7: 42,043,775 D467G probably damaging Het
Zfp618 T A 4: 63,131,115 N417K possibly damaging Het
Other mutations in Pappa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65189316 missense probably damaging 1.00
IGL01340:Pappa APN 4 65323872 missense possibly damaging 0.49
IGL01482:Pappa APN 4 65156034 missense probably benign 0.18
IGL01485:Pappa APN 4 65189299 missense probably damaging 0.96
IGL01759:Pappa APN 4 65205158 splice site probably null
IGL01860:Pappa APN 4 65205092 missense possibly damaging 0.50
IGL01990:Pappa APN 4 65156687 splice site probably benign
IGL02089:Pappa APN 4 65156124 missense possibly damaging 0.75
IGL02153:Pappa APN 4 65297437 missense probably damaging 0.96
IGL02184:Pappa APN 4 65340691 missense possibly damaging 0.82
IGL02324:Pappa APN 4 65196808 missense probably damaging 0.99
IGL02542:Pappa APN 4 65176281 missense probably damaging 1.00
IGL02556:Pappa APN 4 65156626 missense possibly damaging 0.56
IGL02698:Pappa APN 4 65181020 missense probably damaging 1.00
IGL02903:Pappa APN 4 65261980 missense probably damaging 1.00
IGL02974:Pappa APN 4 65204935 missense probably damaging 1.00
IGL03107:Pappa APN 4 65204703 missense probably damaging 1.00
IGL03376:Pappa APN 4 65196834 missense probably benign 0.01
caer UTSW 4 65124891 missense probably damaging 0.98
Maennel UTSW 4 65314587 missense probably benign 0.05
maennelein UTSW 4 65314796 splice site probably null
mama UTSW 4 65204867 missense possibly damaging 0.94
untersuchen UTSW 4 65297257 missense probably damaging 1.00
IGL02980:Pappa UTSW 4 65307774 missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65316232 missense probably damaging 1.00
R0077:Pappa UTSW 4 65307812 missense probably damaging 1.00
R0390:Pappa UTSW 4 65351613 splice site probably null
R0458:Pappa UTSW 4 65155882 missense probably damaging 1.00
R0883:Pappa UTSW 4 65189315 nonsense probably null
R0946:Pappa UTSW 4 65314792 critical splice donor site probably null
R1228:Pappa UTSW 4 65340689 missense probably damaging 1.00
R1327:Pappa UTSW 4 65351603 splice site probably benign
R1489:Pappa UTSW 4 65180948 missense possibly damaging 0.85
R1619:Pappa UTSW 4 65176229 missense probably damaging 1.00
R1856:Pappa UTSW 4 65340743 missense probably damaging 1.00
R2047:Pappa UTSW 4 65231141 splice site probably benign
R2102:Pappa UTSW 4 65316228 nonsense probably null
R2127:Pappa UTSW 4 65297257 missense probably damaging 1.00
R2143:Pappa UTSW 4 65180949 nonsense probably null
R2144:Pappa UTSW 4 65180949 nonsense probably null
R2166:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2167:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2168:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2178:Pappa UTSW 4 65351687 missense probably benign 0.00
R2504:Pappa UTSW 4 65180889 nonsense probably null
R4043:Pappa UTSW 4 65314587 missense probably benign 0.05
R4289:Pappa UTSW 4 65155863 missense probably benign 0.19
R4415:Pappa UTSW 4 65305295 missense probably benign 0.00
R4529:Pappa UTSW 4 65231182 missense probably benign
R4620:Pappa UTSW 4 65327028 missense probably benign 0.43
R4657:Pappa UTSW 4 65314796 splice site probably null
R4658:Pappa UTSW 4 65314796 splice site probably null
R5074:Pappa UTSW 4 65205128 missense probably benign 0.15
R5200:Pappa UTSW 4 65155839 missense probably damaging 1.00
R5420:Pappa UTSW 4 65335780 critical splice donor site probably null
R5469:Pappa UTSW 4 65205152 missense probably benign 0.01
R5651:Pappa UTSW 4 65156352 missense probably damaging 0.99
R5725:Pappa UTSW 4 65189410 missense probably damaging 1.00
R5941:Pappa UTSW 4 65314593 missense possibly damaging 0.52
R6002:Pappa UTSW 4 65297408 missense probably damaging 0.99
R6252:Pappa UTSW 4 65189412 missense probably benign 0.02
R6303:Pappa UTSW 4 65204654 missense probably damaging 1.00
R6322:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6431:Pappa UTSW 4 65156464 missense probably damaging 1.00
R6462:Pappa UTSW 4 65124891 missense probably damaging 0.98
R6484:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6537:Pappa UTSW 4 65297282 missense probably damaging 0.99
R6578:Pappa UTSW 4 65156137 missense possibly damaging 0.48
R6704:Pappa UTSW 4 65204924 missense probably damaging 1.00
R6789:Pappa UTSW 4 65181041 missense probably damaging 1.00
R7023:Pappa UTSW 4 65351718 missense probably benign 0.00
R7139:Pappa UTSW 4 65189450 missense probably benign 0.30
R7158:Pappa UTSW 4 65204867 missense possibly damaging 0.94
R7165:Pappa UTSW 4 65261873 missense probably damaging 1.00
R7196:Pappa UTSW 4 65323891 splice site probably null
R7410:Pappa UTSW 4 65335719 missense probably damaging 1.00
R7457:Pappa UTSW 4 65189266 missense probably damaging 1.00
R7506:Pappa UTSW 4 65231182 missense probably benign 0.00
R7546:Pappa UTSW 4 65156115 missense possibly damaging 0.48
R8111:Pappa UTSW 4 65261992 missense probably damaging 0.99
R8260:Pappa UTSW 4 65316182 missense probably damaging 0.99
R8347:Pappa UTSW 4 65327065 missense probably damaging 1.00
RF006:Pappa UTSW 4 65323873 missense probably benign 0.00
RF020:Pappa UTSW 4 65205045 missense possibly damaging 0.77
X0058:Pappa UTSW 4 65156232 missense probably damaging 1.00
X0060:Pappa UTSW 4 65124941 missense probably benign 0.00
Z1177:Pappa UTSW 4 65307758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGTGAAGGAACAGGTTG -3'
(R):5'- TTAAGGCAACCAGAACTCCATATAG -3'

Sequencing Primer
(F):5'- TGAAACACAGCAAGATTCCTCTTTGC -3'
(R):5'- CCAGAACTCCATATAGAAAAGAGGC -3'
Posted On2020-09-15