Mutagenetix > Incidental Mutation

Incidental Mutation 'R8419:Chil1'

653071

Institutional Source

Beutler Lab

Gene Symbol

Chil1

Ensembl Gene

ENSMUSG00000064246

Gene Name

chitinase-like 1

Synonyms

Brp39, Gp39, Chi3l1

MMRRC Submission

067772-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R8419 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

134182176-134190181 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 134189542 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 367 (D367V)

Ref Sequence

ENSEMBL: ENSMUSP00000080717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038445] [ENSMUST00000082060] [ENSMUST00000132873] [ENSMUST00000133701] [ENSMUST00000153856] [ENSMUST00000156873] [ENSMUST00000191577]

AlphaFold

Q61362

Predicted Effect

probably benign
Transcript: ENSMUST00000038445

SMART Domains

Protein: ENSMUSP00000042195
Gene: ENSMUSG00000042451

Domain	Start	End	E-Value	Type
low complexity region	41	66	N/A	INTRINSIC
FN3	77	160	4.84e-9	SMART
IG	187	270	9.78e-7	SMART
FN3	273	355	1.1e-7	SMART
IGc2	400	467	1.38e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000082060
AA Change: D367V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080717
Gene: ENSMUSG00000064246
AA Change: D367V

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Glyco_18	30	366	1.2e-143	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132873

SMART Domains

Protein: ENSMUSP00000118289
Gene: ENSMUSG00000064246

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_18	2	110	4.4e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133701

SMART Domains

Protein: ENSMUSP00000121471
Gene: ENSMUSG00000064246

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_18	2	106	2e-32	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000153856
AA Change: D359V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117117
Gene: ENSMUSG00000064246
AA Change: D359V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Glyco_18	22	358	1.2e-143	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000156873
AA Change: D357V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119205
Gene: ENSMUSG00000064246
AA Change: D357V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Glyco_18	20	356	1.2e-143	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191577

SMART Domains

Protein: ENSMUSP00000141104
Gene: ENSMUSG00000042451

Domain	Start	End	E-Value	Type
low complexity region	41	66	N/A	INTRINSIC
FN3	77	160	4.84e-9	SMART
IG	187	270	9.78e-7	SMART
FN3	273	355	1.1e-7	SMART
IGc2	400	467	1.38e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chitinases catalyze the hydrolysis of chitin, which is an abundant glycopolymer found in insect exoskeletons and fungal cell walls. The glycoside hydrolase 18 family of chitinases includes eight human family members. This gene encodes a glycoprotein member of the glycosyl hydrolase 18 family. The protein lacks chitinase activity and is secreted by activated macrophages, chondrocytes, neutrophils and synovial cells. The protein is thought to play a role in the process of inflammation and tissue remodeling. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show impaired OVA-induced Th2 responses with reduced splenocyte proliferation, cytokine production and IgE levels, impaired dendritic cell recruitment, higher CD4 T cell, macrophage and eosinophil apoptosis, and reduced CD4 T cell and alternatively activated macrophage numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	G	T	7: 28,143,921	G745C	probably damaging	Het
9930111J21Rik2	A	T	11: 49,019,485	I707N	probably damaging	Het
Abca14	A	G	7: 120,216,266	I246V	probably benign	Het
Adam19	G	A	11: 46,125,023	A337T	possibly damaging	Het
Ankrd40	G	T	11: 94,334,836	G231V	probably damaging	Het
Arhgap5	G	A	12: 52,518,789	V848I	probably damaging	Het
Bmpr2	G	A	1: 59,867,356	R536H	probably damaging	Het
Casz1	T	A	4: 148,948,583	S1310T	probably benign	Het
Cltc	A	G	11: 86,707,566	V990A	probably benign	Het
Col6a3	A	T	1: 90,802,213	S1790R	probably damaging	Het
Comt	C	T	16: 18,411,887	W24*	probably null	Het
Cyp2c70	T	C	19: 40,160,580	E374G	possibly damaging	Het
Dach1	T	C	14: 98,168,640	T224A	probably damaging	Het
Dapk1	G	A	13: 60,740,097	E656K	probably benign	Het
Dicer1	A	G	12: 104,702,677	S1249P	probably benign	Het
Dpp8	A	C	9: 65,080,755	I861L	probably benign	Het
Enam	C	T	5: 88,503,350	S906L	possibly damaging	Het
Eral1	A	T	11: 78,074,080	I429N	possibly damaging	Het
Fbxo10	C	A	4: 45,041,809	G807C	possibly damaging	Het
Fsip2	G	C	2: 82,978,619	E1761Q	probably damaging	Het
Ggnbp2	C	T	11: 84,837,989		probably null	Het
Gm10696	T	C	3: 94,175,614	I297V	probably benign	Het
Gm13088	A	G	4: 143,656,427	I74T	probably damaging	Het
Gm4353	G	A	7: 116,083,549	P266S	probably benign	Het
Gpr84	T	C	15: 103,309,536	N38S	probably damaging	Het
Guca1a	A	T	17: 47,395,555	I115N	probably damaging	Het
Hic1	C	T	11: 75,166,270	V598M	possibly damaging	Het
Itga1	A	T	13: 115,007,068	I309N	probably damaging	Het
Itga11	T	C	9: 62,755,178	S478P	possibly damaging	Het
Kctd8	T	C	5: 69,340,370	D311G	probably damaging	Het
Klhl32	T	C	4: 24,682,203	E127G	possibly damaging	Het
Lama2	T	A	10: 27,422,563	Y179F	probably benign	Het
Lamb2	G	T	9: 108,488,364	R1382L	probably benign	Het
Mrpl1	C	G	5: 96,226,367	A167G	probably benign	Het
Muc3	A	T	5: 137,146,722	N33K		Het
Myt1	A	T	2: 181,782,606	R31*	probably null	Het
Nectin2	T	C	7: 19,717,721	T463A	probably benign	Het
Nectin2	A	T	7: 19,738,078	Y129N	probably damaging	Het
Olfr103	A	G	17: 37,336,575	I219T	possibly damaging	Het
Olfr1297	A	T	2: 111,621,504	M190K	probably benign	Het
Papolb	T	A	5: 142,528,541	N449I	possibly damaging	Het
Parn	T	C	16: 13,648,474	K236R	probably benign	Het
Prelid1	G	A	13: 55,322,885	R42Q	probably damaging	Het
Prelp	A	G	1: 133,915,282	F42L	probably benign	Het
Pygo1	C	T	9: 72,945,098	P189L	probably damaging	Het
Rimbp3	T	A	16: 17,213,022	S1437T	probably damaging	Het
Slc37a2	T	A	9: 37,237,430	D252V	probably benign	Het
Socs7	A	G	11: 97,363,339	K233R	probably benign	Het
Stat4	A	G	1: 52,098,478	D476G	possibly damaging	Het
Tesmin	A	G	19: 3,389,077	D43G	probably benign	Het
Thap1	C	A	8: 26,158,474	Y8*	probably null	Het
Tln1	A	G	4: 43,536,397	L1965P	probably damaging	Het
Tmprss11d	A	G	5: 86,309,306	S303P	probably damaging	Het
Tomm40	C	T	7: 19,701,834	V324M	probably damaging	Het
Vmn1r202	A	T	13: 22,501,815	I144K	probably damaging	Het

Other mutations in Chil1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00977:Chil1	APN	1	134187973	missense	possibly damaging	0.89
IGL01305:Chil1	APN	1	134182816	splice site	probably benign
IGL02051:Chil1	APN	1	134184149	missense	probably damaging	1.00
IGL02724:Chil1	APN	1	134189243	missense	probably damaging	1.00
IGL02754:Chil1	APN	1	134183601	missense	probably damaging	1.00
R0071:Chil1	UTSW	1	134185279	missense	probably benign	0.08
R0071:Chil1	UTSW	1	134185279	missense	probably benign	0.08
R0662:Chil1	UTSW	1	134188573	missense	probably damaging	1.00
R1263:Chil1	UTSW	1	134189242	missense	probably benign	0.02
R1728:Chil1	UTSW	1	134188529	missense	probably damaging	1.00
R1729:Chil1	UTSW	1	134188529	missense	probably damaging	1.00
R1730:Chil1	UTSW	1	134188529	missense	probably damaging	1.00
R1739:Chil1	UTSW	1	134188529	missense	probably damaging	1.00
R1762:Chil1	UTSW	1	134188529	missense	probably damaging	1.00
R1783:Chil1	UTSW	1	134188529	missense	probably damaging	1.00
R1784:Chil1	UTSW	1	134188529	missense	probably damaging	1.00
R1785:Chil1	UTSW	1	134188529	missense	probably damaging	1.00
R4992:Chil1	UTSW	1	134188626	missense	probably benign	0.03
R5860:Chil1	UTSW	1	134185171	missense	probably benign	0.00
R6019:Chil1	UTSW	1	134189572	missense	probably benign	0.00
R6320:Chil1	UTSW	1	134182258	start codon destroyed	probably null	0.07
R7748:Chil1	UTSW	1	134189228	missense	probably benign	0.00
R8992:Chil1	UTSW	1	134187924	missense	probably benign	0.01
R9051:Chil1	UTSW	1	134184181	critical splice donor site	probably null
R9238:Chil1	UTSW	1	134187947	missense	probably damaging	1.00
R9509:Chil1	UTSW	1	134188675	missense	probably damaging	1.00
RF012:Chil1	UTSW	1	134185171	missense	probably benign
X0025:Chil1	UTSW	1	134183632	missense	possibly damaging	0.62
Z1088:Chil1	UTSW	1	134189500	missense	probably benign	0.00
Z1176:Chil1	UTSW	1	134182779	critical splice acceptor site	probably null
Z1176:Chil1	UTSW	1	134189230	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGAGGCTGTTTTGTTCCAAGC -3'
(R):5'- TTCTCCATAGCTGAGCCTGC -3'

Sequencing Primer
(F):5'- TTTGTTCCAAGCAGCAGGAG -3'
(R):5'- CCTTACACAGGTGCCAAGG -3'

Posted On

2020-10-20