Incidental Mutation 'R8419:Lama2'
ID 653099
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Name laminin, alpha 2
Synonyms mer, merosin
MMRRC Submission 067772-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R8419 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 26857281-27493021 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 27298559 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 179 (Y179F)
Ref Sequence ENSEMBL: ENSMUSP00000090304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639] [ENSMUST00000189575]
AlphaFold no structure available at present
PDB Structure LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR [X-RAY DIFFRACTION]
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR, CA1 SITE MUTANT [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE FIFTH LAMININ G-LIKE MODULE OF THE MOUSE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE LG1-3 REGION OF THE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000092639
AA Change: Y179F

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: Y179F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189575
AA Change: Y179F

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140716
Gene: ENSMUSG00000019899
AA Change: Y179F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 2.5e-131 SMART
EGF_Lam 283 337 1e-6 SMART
EGF_Lam 340 407 7.7e-11 SMART
EGF_Lam 410 462 2.6e-9 SMART
EGF_Lam 465 511 4.5e-6 SMART
LamB 574 706 1.4e-46 SMART
Pfam:Laminin_EGF 715 745 1.7e-2 PFAM
EGF_Lam 753 800 1.9e-12 SMART
EGF_Lam 803 858 1.4e-11 SMART
EGF_Lam 861 911 6.7e-14 SMART
EGF_Lam 914 960 3.6e-14 SMART
EGF_Lam 963 1007 2.9e-14 SMART
EGF_Lam 1010 1053 6.1e-15 SMART
EGF_Lam 1056 1099 1.1e-9 SMART
EGF_Lam 1102 1159 1.5e-11 SMART
LamB 1225 1349 1.4e-45 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 48,910,312 (GRCm39) I707N probably damaging Het
Abca14 A G 7: 119,815,489 (GRCm39) I246V probably benign Het
Adam19 G A 11: 46,015,850 (GRCm39) A337T possibly damaging Het
Ankrd40 G T 11: 94,225,662 (GRCm39) G231V probably damaging Het
Arhgap5 G A 12: 52,565,572 (GRCm39) V848I probably damaging Het
Bmpr2 G A 1: 59,906,515 (GRCm39) R536H probably damaging Het
Casz1 T A 4: 149,033,040 (GRCm39) S1310T probably benign Het
Chi3l1 A T 1: 134,117,280 (GRCm39) D367V probably damaging Het
Cltc A G 11: 86,598,392 (GRCm39) V990A probably benign Het
Col6a3 A T 1: 90,729,935 (GRCm39) S1790R probably damaging Het
Comt C T 16: 18,230,637 (GRCm39) W24* probably null Het
Cyp2c70 T C 19: 40,149,024 (GRCm39) E374G possibly damaging Het
Dach1 T C 14: 98,406,076 (GRCm39) T224A probably damaging Het
Dapk1 G A 13: 60,887,911 (GRCm39) E656K probably benign Het
Dicer1 A G 12: 104,668,936 (GRCm39) S1249P probably benign Het
Dpp8 A C 9: 64,988,037 (GRCm39) I861L probably benign Het
Enam C T 5: 88,651,209 (GRCm39) S906L possibly damaging Het
Eral1 A T 11: 77,964,906 (GRCm39) I429N possibly damaging Het
Fbxo10 C A 4: 45,041,809 (GRCm39) G807C possibly damaging Het
Fcgbpl1 G T 7: 27,843,346 (GRCm39) G745C probably damaging Het
Fsip2 G C 2: 82,808,963 (GRCm39) E1761Q probably damaging Het
Ggnbp2 C T 11: 84,728,815 (GRCm39) probably null Het
Gm4353 G A 7: 115,682,784 (GRCm39) P266S probably benign Het
Gpr84 T C 15: 103,217,963 (GRCm39) N38S probably damaging Het
Guca1a A T 17: 47,706,480 (GRCm39) I115N probably damaging Het
Hic1 C T 11: 75,057,096 (GRCm39) V598M possibly damaging Het
Itga1 A T 13: 115,143,604 (GRCm39) I309N probably damaging Het
Itga11 T C 9: 62,662,460 (GRCm39) S478P possibly damaging Het
Kctd8 T C 5: 69,497,713 (GRCm39) D311G probably damaging Het
Klhl32 T C 4: 24,682,203 (GRCm39) E127G possibly damaging Het
Lamb2 G T 9: 108,365,563 (GRCm39) R1382L probably benign Het
Mrpl1 C G 5: 96,374,226 (GRCm39) A167G probably benign Het
Muc17 A T 5: 137,175,570 (GRCm39) N33K Het
Myt1 A T 2: 181,424,399 (GRCm39) R31* probably null Het
Nectin2 T C 7: 19,451,646 (GRCm39) T463A probably benign Het
Nectin2 A T 7: 19,472,003 (GRCm39) Y129N probably damaging Het
Or12d13 A G 17: 37,647,466 (GRCm39) I219T possibly damaging Het
Or4k47 A T 2: 111,451,849 (GRCm39) M190K probably benign Het
Papolb T A 5: 142,514,296 (GRCm39) N449I possibly damaging Het
Parn T C 16: 13,466,338 (GRCm39) K236R probably benign Het
Pramel22 A G 4: 143,382,997 (GRCm39) I74T probably damaging Het
Prelid1 G A 13: 55,470,698 (GRCm39) R42Q probably damaging Het
Prelp A G 1: 133,843,020 (GRCm39) F42L probably benign Het
Pygo1 C T 9: 72,852,380 (GRCm39) P189L probably damaging Het
Rimbp3 T A 16: 17,030,886 (GRCm39) S1437T probably damaging Het
Slc37a2 T A 9: 37,148,726 (GRCm39) D252V probably benign Het
Socs7 A G 11: 97,254,165 (GRCm39) K233R probably benign Het
Spopfm2 T C 3: 94,082,921 (GRCm39) I297V probably benign Het
Stat4 A G 1: 52,137,637 (GRCm39) D476G possibly damaging Het
Tesmin A G 19: 3,439,077 (GRCm39) D43G probably benign Het
Thap1 C A 8: 26,648,502 (GRCm39) Y8* probably null Het
Tln1 A G 4: 43,536,397 (GRCm39) L1965P probably damaging Het
Tmprss11d A G 5: 86,457,165 (GRCm39) S303P probably damaging Het
Tomm40 C T 7: 19,435,759 (GRCm39) V324M probably damaging Het
Vmn1r202 A T 13: 22,685,985 (GRCm39) I144K probably damaging Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27,064,261 (GRCm39) missense probably benign 0.01
IGL00467:Lama2 APN 10 27,343,193 (GRCm39) splice site probably benign
IGL00470:Lama2 APN 10 27,119,738 (GRCm39) missense probably benign 0.22
IGL00517:Lama2 APN 10 27,073,326 (GRCm39) missense probably benign 0.01
IGL00541:Lama2 APN 10 27,064,302 (GRCm39) missense probably benign 0.14
IGL00931:Lama2 APN 10 26,882,772 (GRCm39) missense possibly damaging 0.92
IGL00951:Lama2 APN 10 26,906,281 (GRCm39) missense probably benign 0.03
IGL00988:Lama2 APN 10 27,245,011 (GRCm39) nonsense probably null
IGL01098:Lama2 APN 10 26,907,108 (GRCm39) missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27,084,425 (GRCm39) missense probably benign 0.00
IGL01293:Lama2 APN 10 27,107,632 (GRCm39) missense probably benign 0.38
IGL01338:Lama2 APN 10 27,064,268 (GRCm39) missense probably benign 0.13
IGL01609:Lama2 APN 10 27,220,417 (GRCm39) missense probably benign 0.03
IGL01643:Lama2 APN 10 26,946,368 (GRCm39) splice site probably benign
IGL01675:Lama2 APN 10 27,064,050 (GRCm39) missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27,141,041 (GRCm39) missense probably benign 0.33
IGL01694:Lama2 APN 10 26,882,738 (GRCm39) missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27,065,270 (GRCm39) splice site probably benign
IGL01885:Lama2 APN 10 26,981,135 (GRCm39) nonsense probably null
IGL01935:Lama2 APN 10 27,298,600 (GRCm39) missense probably damaging 0.98
IGL01994:Lama2 APN 10 27,343,199 (GRCm39) critical splice donor site probably null
IGL02041:Lama2 APN 10 26,860,322 (GRCm39) missense probably damaging 1.00
IGL02067:Lama2 APN 10 27,052,792 (GRCm39) missense probably benign 0.02
IGL02097:Lama2 APN 10 27,014,956 (GRCm39) missense probably benign 0.09
IGL02179:Lama2 APN 10 26,946,360 (GRCm39) missense probably benign 0.01
IGL02268:Lama2 APN 10 26,877,112 (GRCm39) splice site probably benign
IGL02302:Lama2 APN 10 27,088,039 (GRCm39) missense probably benign 0.06
IGL02363:Lama2 APN 10 27,242,062 (GRCm39) missense probably damaging 1.00
IGL02378:Lama2 APN 10 26,919,652 (GRCm39) missense probably damaging 0.99
IGL02642:Lama2 APN 10 27,343,269 (GRCm39) missense probably damaging 1.00
IGL02676:Lama2 APN 10 26,994,489 (GRCm39) missense probably benign 0.00
IGL02695:Lama2 APN 10 26,876,771 (GRCm39) missense probably benign
IGL02735:Lama2 APN 10 26,980,124 (GRCm39) missense probably damaging 1.00
IGL02794:Lama2 APN 10 26,917,227 (GRCm39) missense possibly damaging 0.73
IGL02823:Lama2 APN 10 26,877,141 (GRCm39) missense probably damaging 1.00
IGL02869:Lama2 APN 10 26,891,534 (GRCm39) missense probably damaging 0.99
IGL02942:Lama2 APN 10 26,917,216 (GRCm39) missense probably damaging 1.00
IGL03201:Lama2 APN 10 27,220,566 (GRCm39) nonsense probably null
IGL03268:Lama2 APN 10 27,298,649 (GRCm39) missense probably damaging 1.00
IGL03288:Lama2 APN 10 27,245,047 (GRCm39) missense probably damaging 1.00
IGL03380:Lama2 APN 10 26,926,261 (GRCm39) missense probably damaging 1.00
IGL03407:Lama2 APN 10 27,223,017 (GRCm39) missense probably damaging 1.00
cowboy UTSW 10 26,919,639 (GRCm39) frame shift probably null
petri UTSW 10 26,869,394 (GRCm39) splice site probably null
PIT4362001:Lama2 UTSW 10 27,245,132 (GRCm39) missense probably damaging 1.00
PIT4382001:Lama2 UTSW 10 27,080,901 (GRCm39) missense probably damaging 1.00
PIT4431001:Lama2 UTSW 10 26,977,426 (GRCm39) missense probably damaging 1.00
R0038:Lama2 UTSW 10 26,862,793 (GRCm39) missense probably benign 0.02
R0038:Lama2 UTSW 10 26,862,793 (GRCm39) missense probably benign 0.02
R0114:Lama2 UTSW 10 26,869,064 (GRCm39) nonsense probably null
R0142:Lama2 UTSW 10 27,063,841 (GRCm39) missense probably benign
R0313:Lama2 UTSW 10 26,869,394 (GRCm39) splice site probably null
R0376:Lama2 UTSW 10 26,891,542 (GRCm39) missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27,066,621 (GRCm39) missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26,866,863 (GRCm39) missense probably damaging 1.00
R0607:Lama2 UTSW 10 27,065,127 (GRCm39) missense probably benign 0.34
R0648:Lama2 UTSW 10 26,865,372 (GRCm39) missense probably benign 0.00
R0667:Lama2 UTSW 10 27,220,406 (GRCm39) splice site probably null
R0760:Lama2 UTSW 10 26,920,429 (GRCm39) critical splice donor site probably null
R1240:Lama2 UTSW 10 26,917,120 (GRCm39) missense probably damaging 1.00
R1385:Lama2 UTSW 10 27,100,039 (GRCm39) missense probably benign 0.11
R1433:Lama2 UTSW 10 27,063,750 (GRCm39) missense probably damaging 1.00
R1434:Lama2 UTSW 10 27,084,366 (GRCm39) missense probably damaging 1.00
R1574:Lama2 UTSW 10 27,200,750 (GRCm39) missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27,200,750 (GRCm39) missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27,244,981 (GRCm39) missense probably damaging 1.00
R1702:Lama2 UTSW 10 27,066,525 (GRCm39) missense probably benign
R1703:Lama2 UTSW 10 27,142,667 (GRCm39) missense probably damaging 1.00
R1769:Lama2 UTSW 10 27,084,403 (GRCm39) missense probably benign
R1769:Lama2 UTSW 10 27,084,402 (GRCm39) missense probably damaging 1.00
R1846:Lama2 UTSW 10 27,088,092 (GRCm39) missense probably damaging 1.00
R1859:Lama2 UTSW 10 26,907,078 (GRCm39) missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26,860,490 (GRCm39) missense probably damaging 1.00
R1903:Lama2 UTSW 10 27,064,395 (GRCm39) missense probably damaging 1.00
R1906:Lama2 UTSW 10 26,932,523 (GRCm39) critical splice donor site probably null
R1958:Lama2 UTSW 10 26,857,594 (GRCm39) missense probably damaging 0.97
R1959:Lama2 UTSW 10 27,298,614 (GRCm39) missense probably damaging 1.00
R1977:Lama2 UTSW 10 26,866,796 (GRCm39) splice site probably null
R2063:Lama2 UTSW 10 27,040,922 (GRCm39) missense probably damaging 1.00
R2079:Lama2 UTSW 10 27,245,049 (GRCm39) missense probably damaging 0.99
R2085:Lama2 UTSW 10 27,080,837 (GRCm39) nonsense probably null
R2125:Lama2 UTSW 10 26,920,449 (GRCm39) nonsense probably null
R2140:Lama2 UTSW 10 26,930,690 (GRCm39) splice site probably null
R2219:Lama2 UTSW 10 26,919,565 (GRCm39) missense probably damaging 0.99
R2259:Lama2 UTSW 10 26,907,123 (GRCm39) missense probably benign 0.00
R2265:Lama2 UTSW 10 26,868,932 (GRCm39) missense probably damaging 1.00
R2266:Lama2 UTSW 10 26,862,793 (GRCm39) missense probably benign 0.02
R2267:Lama2 UTSW 10 26,868,932 (GRCm39) missense probably damaging 1.00
R2268:Lama2 UTSW 10 26,868,932 (GRCm39) missense probably damaging 1.00
R2269:Lama2 UTSW 10 26,868,932 (GRCm39) missense probably damaging 1.00
R2862:Lama2 UTSW 10 27,298,608 (GRCm39) nonsense probably null
R2912:Lama2 UTSW 10 26,876,799 (GRCm39) missense probably benign
R2999:Lama2 UTSW 10 26,865,417 (GRCm39) missense probably benign 0.18
R3034:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3081:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3107:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3109:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3436:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3437:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3706:Lama2 UTSW 10 27,014,992 (GRCm39) missense probably damaging 1.00
R3780:Lama2 UTSW 10 27,335,335 (GRCm39) missense probably damaging 1.00
R3807:Lama2 UTSW 10 27,066,661 (GRCm39) frame shift probably null
R3919:Lama2 UTSW 10 26,994,501 (GRCm39) missense probably damaging 1.00
R4014:Lama2 UTSW 10 26,860,372 (GRCm39) missense probably damaging 1.00
R4131:Lama2 UTSW 10 26,917,170 (GRCm39) missense probably benign 0.00
R4190:Lama2 UTSW 10 27,142,660 (GRCm39) missense probably damaging 0.96
R4273:Lama2 UTSW 10 27,223,050 (GRCm39) missense probably damaging 1.00
R4358:Lama2 UTSW 10 26,860,489 (GRCm39) missense probably damaging 1.00
R4407:Lama2 UTSW 10 27,088,124 (GRCm39) small deletion probably benign
R4415:Lama2 UTSW 10 26,865,340 (GRCm39) nonsense probably null
R4426:Lama2 UTSW 10 27,298,554 (GRCm39) missense probably damaging 1.00
R4590:Lama2 UTSW 10 26,865,410 (GRCm39) missense probably benign 0.00
R4615:Lama2 UTSW 10 26,857,520 (GRCm39) missense probably damaging 0.99
R4736:Lama2 UTSW 10 27,080,925 (GRCm39) missense probably damaging 1.00
R4754:Lama2 UTSW 10 26,994,527 (GRCm39) missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27,343,267 (GRCm39) missense probably damaging 1.00
R4834:Lama2 UTSW 10 26,882,745 (GRCm39) missense probably benign 0.30
R4856:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4858:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4859:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4897:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4898:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4899:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4907:Lama2 UTSW 10 27,040,942 (GRCm39) missense probably benign 0.11
R4911:Lama2 UTSW 10 27,014,923 (GRCm39) missense probably damaging 1.00
R4924:Lama2 UTSW 10 27,245,137 (GRCm39) missense probably damaging 0.98
R5023:Lama2 UTSW 10 27,066,500 (GRCm39) missense probably damaging 0.97
R5057:Lama2 UTSW 10 27,040,982 (GRCm39) missense probably damaging 1.00
R5070:Lama2 UTSW 10 27,226,247 (GRCm39) critical splice donor site probably null
R5116:Lama2 UTSW 10 26,994,556 (GRCm39) missense probably benign 0.08
R5177:Lama2 UTSW 10 27,066,699 (GRCm39) missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27,222,999 (GRCm39) missense probably damaging 0.96
R5289:Lama2 UTSW 10 27,088,069 (GRCm39) nonsense probably null
R5327:Lama2 UTSW 10 27,014,942 (GRCm39) missense probably benign
R5424:Lama2 UTSW 10 26,860,392 (GRCm39) missense probably damaging 1.00
R5469:Lama2 UTSW 10 26,917,185 (GRCm39) missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26,866,876 (GRCm39) missense probably damaging 0.99
R5667:Lama2 UTSW 10 27,066,540 (GRCm39) missense probably damaging 1.00
R5671:Lama2 UTSW 10 27,066,540 (GRCm39) missense probably damaging 1.00
R5815:Lama2 UTSW 10 26,862,847 (GRCm39) missense probably damaging 1.00
R5917:Lama2 UTSW 10 27,066,693 (GRCm39) missense probably damaging 1.00
R5935:Lama2 UTSW 10 26,891,494 (GRCm39) missense probably benign
R5976:Lama2 UTSW 10 27,066,672 (GRCm39) missense probably benign 0.00
R5979:Lama2 UTSW 10 27,111,728 (GRCm39) missense probably damaging 0.99
R6004:Lama2 UTSW 10 27,111,781 (GRCm39) missense probably benign 0.01
R6180:Lama2 UTSW 10 26,857,495 (GRCm39) missense probably benign 0.03
R6198:Lama2 UTSW 10 27,064,018 (GRCm39) missense probably damaging 1.00
R6257:Lama2 UTSW 10 26,862,895 (GRCm39) missense possibly damaging 0.85
R6271:Lama2 UTSW 10 26,899,325 (GRCm39) missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27,066,543 (GRCm39) missense probably damaging 0.96
R6354:Lama2 UTSW 10 27,088,064 (GRCm39) missense probably damaging 1.00
R6431:Lama2 UTSW 10 26,929,027 (GRCm39) missense possibly damaging 0.50
R6499:Lama2 UTSW 10 26,907,154 (GRCm39) missense probably damaging 1.00
R6535:Lama2 UTSW 10 26,980,127 (GRCm39) missense probably damaging 1.00
R6545:Lama2 UTSW 10 27,052,793 (GRCm39) missense probably benign
R6636:Lama2 UTSW 10 27,000,564 (GRCm39) missense probably benign 0.13
R6891:Lama2 UTSW 10 27,204,078 (GRCm39) nonsense probably null
R6891:Lama2 UTSW 10 27,204,068 (GRCm39) nonsense probably null
R6902:Lama2 UTSW 10 26,857,625 (GRCm39) missense probably damaging 1.00
R6908:Lama2 UTSW 10 26,907,192 (GRCm39) splice site probably null
R7168:Lama2 UTSW 10 27,242,148 (GRCm39) critical splice acceptor site probably null
R7233:Lama2 UTSW 10 27,107,659 (GRCm39) missense probably damaging 1.00
R7272:Lama2 UTSW 10 27,000,552 (GRCm39) missense probably damaging 1.00
R7274:Lama2 UTSW 10 26,995,976 (GRCm39) missense probably damaging 0.99
R7419:Lama2 UTSW 10 27,142,630 (GRCm39) missense probably benign
R7423:Lama2 UTSW 10 27,088,222 (GRCm39) missense probably benign 0.00
R7554:Lama2 UTSW 10 27,031,492 (GRCm39) missense probably damaging 1.00
R7569:Lama2 UTSW 10 27,141,046 (GRCm39) missense probably damaging 1.00
R7574:Lama2 UTSW 10 26,882,726 (GRCm39) missense probably benign 0.03
R7584:Lama2 UTSW 10 26,980,257 (GRCm39) missense possibly damaging 0.78
R7586:Lama2 UTSW 10 26,977,389 (GRCm39) missense probably benign 0.00
R7603:Lama2 UTSW 10 27,142,676 (GRCm39) missense possibly damaging 0.55
R7691:Lama2 UTSW 10 27,084,389 (GRCm39) missense possibly damaging 0.67
R7750:Lama2 UTSW 10 26,866,920 (GRCm39) missense probably damaging 0.97
R7841:Lama2 UTSW 10 27,031,529 (GRCm39) missense probably benign 0.00
R7864:Lama2 UTSW 10 26,932,611 (GRCm39) missense probably benign 0.08
R7960:Lama2 UTSW 10 26,869,094 (GRCm39) missense probably benign 0.04
R7964:Lama2 UTSW 10 27,099,977 (GRCm39) critical splice donor site probably null
R7980:Lama2 UTSW 10 27,239,609 (GRCm39) missense probably damaging 0.98
R8013:Lama2 UTSW 10 27,220,494 (GRCm39) missense probably benign 0.00
R8028:Lama2 UTSW 10 27,204,145 (GRCm39) missense probably benign 0.13
R8097:Lama2 UTSW 10 27,066,660 (GRCm39) nonsense probably null
R8100:Lama2 UTSW 10 26,917,113 (GRCm39) missense probably benign 0.03
R8110:Lama2 UTSW 10 26,866,866 (GRCm39) missense probably damaging 1.00
R8122:Lama2 UTSW 10 26,930,592 (GRCm39) missense possibly damaging 0.87
R8264:Lama2 UTSW 10 27,343,218 (GRCm39) missense probably benign 0.07
R8315:Lama2 UTSW 10 27,298,655 (GRCm39) missense probably damaging 1.00
R8318:Lama2 UTSW 10 26,860,334 (GRCm39) missense probably damaging 1.00
R8475:Lama2 UTSW 10 26,977,369 (GRCm39) missense possibly damaging 0.69
R8735:Lama2 UTSW 10 27,066,530 (GRCm39) missense probably damaging 1.00
R8754:Lama2 UTSW 10 26,877,147 (GRCm39) missense possibly damaging 0.83
R8817:Lama2 UTSW 10 27,063,869 (GRCm39) missense probably damaging 1.00
R8851:Lama2 UTSW 10 27,242,119 (GRCm39) missense possibly damaging 0.94
R8859:Lama2 UTSW 10 27,335,384 (GRCm39) missense possibly damaging 0.58
R8886:Lama2 UTSW 10 27,245,157 (GRCm39) splice site probably benign
R8937:Lama2 UTSW 10 26,862,816 (GRCm39) missense probably damaging 1.00
R8993:Lama2 UTSW 10 27,298,710 (GRCm39) missense possibly damaging 0.91
R9025:Lama2 UTSW 10 26,860,367 (GRCm39) missense probably benign 0.00
R9027:Lama2 UTSW 10 27,080,881 (GRCm39) missense probably damaging 1.00
R9047:Lama2 UTSW 10 26,882,697 (GRCm39) missense possibly damaging 0.50
R9075:Lama2 UTSW 10 26,857,588 (GRCm39) missense probably damaging 1.00
R9135:Lama2 UTSW 10 27,298,515 (GRCm39) missense probably damaging 1.00
R9165:Lama2 UTSW 10 26,929,022 (GRCm39) critical splice donor site probably null
R9192:Lama2 UTSW 10 27,204,181 (GRCm39) missense possibly damaging 0.95
R9254:Lama2 UTSW 10 27,298,685 (GRCm39) missense probably damaging 0.96
R9326:Lama2 UTSW 10 26,906,193 (GRCm39) missense probably benign 0.04
R9356:Lama2 UTSW 10 27,088,186 (GRCm39) missense probably damaging 0.99
R9358:Lama2 UTSW 10 27,492,761 (GRCm39) missense unknown
R9358:Lama2 UTSW 10 27,064,378 (GRCm39) missense possibly damaging 0.95
R9376:Lama2 UTSW 10 26,994,620 (GRCm39) missense probably benign 0.11
R9381:Lama2 UTSW 10 27,064,023 (GRCm39) nonsense probably null
R9397:Lama2 UTSW 10 26,981,117 (GRCm39) missense probably benign 0.01
R9460:Lama2 UTSW 10 27,298,475 (GRCm39) missense probably damaging 1.00
R9478:Lama2 UTSW 10 26,891,478 (GRCm39) missense probably damaging 0.98
R9503:Lama2 UTSW 10 26,865,440 (GRCm39) missense possibly damaging 0.57
R9514:Lama2 UTSW 10 27,100,015 (GRCm39) missense probably benign 0.00
R9515:Lama2 UTSW 10 26,877,170 (GRCm39) missense probably benign 0.23
R9516:Lama2 UTSW 10 27,100,015 (GRCm39) missense probably benign 0.00
R9533:Lama2 UTSW 10 26,862,871 (GRCm39) missense probably damaging 1.00
R9619:Lama2 UTSW 10 27,064,282 (GRCm39) missense probably damaging 1.00
R9721:Lama2 UTSW 10 27,343,338 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AGTGCACTGACGTTAGTTACTG -3'
(R):5'- CGTCTTTCTATTTGGAATGACTGAG -3'

Sequencing Primer
(F):5'- CACTGACGTTAGTTACTGACACATTC -3'
(R):5'- GAACTCAGAGTGATGCTTTTGTCACC -3'
Posted On 2020-10-20