Mutagenetix > Incidental Mutation

Incidental Mutation 'R8419:Casz1'

653080

Institutional Source

Beutler Lab

Gene Symbol

Casz1

Ensembl Gene

ENSMUSG00000028977

Gene Name

castor zinc finger 1

Synonyms

D4Ertd432e, 2410019P08Rik, Cst, castor

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8419 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

148804429-148954889 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 148948583 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1310 (S1310T)

Ref Sequence

ENSEMBL: ENSMUSP00000112978 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094464] [ENSMUST00000122222]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000094464

SMART Domains

Protein: ENSMUSP00000092035
Gene: ENSMUSG00000028977

Domain	Start	End	E-Value	Type
low complexity region	403	420	N/A	INTRINSIC
ZnF_C2H2	489	514	5.34e0	SMART
ZnF_C2H2	550	574	8.09e-1	SMART
ZnF_C2H2	609	633	9.3e-1	SMART
low complexity region	643	658	N/A	INTRINSIC
ZnF_C2H2	667	691	1.1e-2	SMART
low complexity region	698	711	N/A	INTRINSIC
low complexity region	728	766	N/A	INTRINSIC
low complexity region	796	807	N/A	INTRINSIC
low complexity region	810	834	N/A	INTRINSIC
low complexity region	875	890	N/A	INTRINSIC
low complexity region	951	957	N/A	INTRINSIC
ZnF_C2H2	1031	1055	2.29e1	SMART
low complexity region	1080	1091	N/A	INTRINSIC
low complexity region	1105	1115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122222
AA Change: S1310T

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977
AA Change: S1310T

Domain	Start	End	E-Value	Type
low complexity region	403	420	N/A	INTRINSIC
ZnF_C2H2	489	514	5.34e0	SMART
ZnF_C2H2	550	574	8.09e-1	SMART
ZnF_C2H2	609	633	9.3e-1	SMART
low complexity region	643	658	N/A	INTRINSIC
ZnF_C2H2	667	691	1.1e-2	SMART
low complexity region	698	711	N/A	INTRINSIC
low complexity region	728	766	N/A	INTRINSIC
low complexity region	796	807	N/A	INTRINSIC
low complexity region	810	834	N/A	INTRINSIC
low complexity region	875	890	N/A	INTRINSIC
low complexity region	951	957	N/A	INTRINSIC
ZnF_C2H2	1031	1055	2.29e1	SMART
low complexity region	1080	1091	N/A	INTRINSIC
low complexity region	1105	1115	N/A	INTRINSIC
ZnF_C2H2	1182	1206	1.59e1	SMART
ZnF_C2H2	1242	1266	2.47e1	SMART
ZnF_C2H2	1300	1324	3.47e0	SMART
ZnF_C2H2	1457	1481	7.89e0	SMART
ZnF_C2H2	1515	1537	3.21e1	SMART
ZnF_C2H2	1571	1595	3.99e0	SMART
low complexity region	1632	1649	N/A	INTRINSIC
SCOP:d1qbkb_	1675	1742	2e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	G	T	7: 28,143,921	G745C	probably damaging	Het
9930111J21Rik2	A	T	11: 49,019,485	I707N	probably damaging	Het
Abca14	A	G	7: 120,216,266	I246V	probably benign	Het
Adam19	G	A	11: 46,125,023	A337T	possibly damaging	Het
Ankrd40	G	T	11: 94,334,836	G231V	probably damaging	Het
Arhgap5	G	A	12: 52,518,789	V848I	probably damaging	Het
Bmpr2	G	A	1: 59,867,356	R536H	probably damaging	Het
Chil1	A	T	1: 134,189,542	D367V	probably damaging	Het
Cltc	A	G	11: 86,707,566	V990A	probably benign	Het
Col6a3	A	T	1: 90,802,213	S1790R	probably damaging	Het
Comt	C	T	16: 18,411,887	W24*	probably null	Het
Cyp2c70	T	C	19: 40,160,580	E374G	possibly damaging	Het
Dach1	T	C	14: 98,168,640	T224A	probably damaging	Het
Dapk1	G	A	13: 60,740,097	E656K	probably benign	Het
Dicer1	A	G	12: 104,702,677	S1249P	probably benign	Het
Dpp8	A	C	9: 65,080,755	I861L	probably benign	Het
Enam	C	T	5: 88,503,350	S906L	possibly damaging	Het
Eral1	A	T	11: 78,074,080	I429N	possibly damaging	Het
Fbxo10	C	A	4: 45,041,809	G807C	possibly damaging	Het
Fsip2	G	C	2: 82,978,619	E1761Q	probably damaging	Het
Ggnbp2	C	T	11: 84,837,989		probably null	Het
Gm10696	T	C	3: 94,175,614	I297V	probably benign	Het
Gm13088	A	G	4: 143,656,427	I74T	probably damaging	Het
Gm4353	G	A	7: 116,083,549	P266S	probably benign	Het
Gpr84	T	C	15: 103,309,536	N38S	probably damaging	Het
Guca1a	A	T	17: 47,395,555	I115N	probably damaging	Het
Hic1	C	T	11: 75,166,270	V598M	possibly damaging	Het
Itga1	A	T	13: 115,007,068	I309N	probably damaging	Het
Itga11	T	C	9: 62,755,178	S478P	possibly damaging	Het
Kctd8	T	C	5: 69,340,370	D311G	probably damaging	Het
Klhl32	T	C	4: 24,682,203	E127G	possibly damaging	Het
Lama2	T	A	10: 27,422,563	Y179F	probably benign	Het
Lamb2	G	T	9: 108,488,364	R1382L	probably benign	Het
Mrpl1	C	G	5: 96,226,367	A167G	probably benign	Het
Muc3	A	T	5: 137,146,722	N33K		Het
Myt1	A	T	2: 181,782,606	R31*	probably null	Het
Nectin2	T	C	7: 19,717,721	T463A	probably benign	Het
Nectin2	A	T	7: 19,738,078	Y129N	probably damaging	Het
Olfr103	A	G	17: 37,336,575	I219T	possibly damaging	Het
Olfr1297	A	T	2: 111,621,504	M190K	probably benign	Het
Papolb	T	A	5: 142,528,541	N449I	possibly damaging	Het
Parn	T	C	16: 13,648,474	K236R	probably benign	Het
Prelid1	G	A	13: 55,322,885	R42Q	probably damaging	Het
Prelp	A	G	1: 133,915,282	F42L	probably benign	Het
Pygo1	C	T	9: 72,945,098	P189L	probably damaging	Het
Rimbp3	T	A	16: 17,213,022	S1437T	probably damaging	Het
Slc37a2	T	A	9: 37,237,430	D252V	probably benign	Het
Socs7	A	G	11: 97,363,339	K233R	probably benign	Het
Stat4	A	G	1: 52,098,478	D476G	possibly damaging	Het
Tesmin	A	G	19: 3,389,077	D43G	probably benign	Het
Thap1	C	A	8: 26,158,474	Y8*	probably null	Het
Tln1	A	G	4: 43,536,397	L1965P	probably damaging	Het
Tmprss11d	A	G	5: 86,309,306	S303P	probably damaging	Het
Tomm40	C	T	7: 19,701,834	V324M	probably damaging	Het
Vmn1r202	A	T	13: 22,501,815	I144K	probably damaging	Het

Other mutations in Casz1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00914:Casz1	APN	4	148929371	missense	probably damaging	1.00
IGL02137:Casz1	APN	4	148933468	missense	possibly damaging	0.71
IGL02176:Casz1	APN	4	148934619	missense	probably damaging	1.00
IGL02629:Casz1	APN	4	148944391	missense	probably benign	0.01
IGL02871:Casz1	APN	4	148944319	missense	possibly damaging	0.93
FR4340:Casz1	UTSW	4	148952302	small deletion	probably benign
G1Funyon:Casz1	UTSW	4	148946043	missense	probably damaging	0.98
H8562:Casz1	UTSW	4	148933451	missense	probably damaging	1.00
R0090:Casz1	UTSW	4	148933411	missense	probably benign	0.00
R0389:Casz1	UTSW	4	148948911	missense	possibly damaging	0.83
R0443:Casz1	UTSW	4	148948911	missense	possibly damaging	0.83
R0550:Casz1	UTSW	4	148952284	small deletion	probably benign
R0597:Casz1	UTSW	4	148944394	missense	probably benign	0.00
R1117:Casz1	UTSW	4	148934595	missense	probably damaging	1.00
R1476:Casz1	UTSW	4	148946171	missense	probably benign	0.05
R1540:Casz1	UTSW	4	148942900	unclassified	probably benign
R1610:Casz1	UTSW	4	148929087	missense	possibly damaging	0.54
R1764:Casz1	UTSW	4	148942900	unclassified	probably benign
R1779:Casz1	UTSW	4	148932937	missense	probably benign	0.00
R1874:Casz1	UTSW	4	148943211	missense	probably damaging	0.99
R1902:Casz1	UTSW	4	148936195	missense	possibly damaging	0.95
R1914:Casz1	UTSW	4	148932958	missense	probably damaging	1.00
R2126:Casz1	UTSW	4	148946064	missense	probably damaging	0.99
R2261:Casz1	UTSW	4	148929099	missense	probably damaging	0.96
R2262:Casz1	UTSW	4	148929099	missense	probably damaging	0.96
R3874:Casz1	UTSW	4	148939589	intron	probably benign
R4019:Casz1	UTSW	4	148932878	missense	probably benign	0.00
R4355:Casz1	UTSW	4	148952335	missense	unknown
R4420:Casz1	UTSW	4	148948918	missense	possibly damaging	0.90
R4610:Casz1	UTSW	4	148933267	missense	probably damaging	1.00
R4632:Casz1	UTSW	4	148951855	missense	possibly damaging	0.71
R4762:Casz1	UTSW	4	148938981	missense	probably damaging	1.00
R4824:Casz1	UTSW	4	148944571	missense	probably damaging	1.00
R4907:Casz1	UTSW	4	148944541	missense	probably damaging	1.00
R5628:Casz1	UTSW	4	148946096	missense	probably damaging	1.00
R5736:Casz1	UTSW	4	148929410	missense	probably benign	0.00
R5929:Casz1	UTSW	4	148938696	missense	probably damaging	1.00
R5929:Casz1	UTSW	4	148938969	missense	probably damaging	1.00
R5932:Casz1	UTSW	4	148939113	missense	possibly damaging	0.52
R6016:Casz1	UTSW	4	148934584	missense	probably damaging	1.00
R6019:Casz1	UTSW	4	148947038	missense	probably damaging	0.99
R6139:Casz1	UTSW	4	148951697	missense	probably damaging	1.00
R6223:Casz1	UTSW	4	148933383	missense	probably damaging	1.00
R6239:Casz1	UTSW	4	148938277	missense	probably damaging	1.00
R6323:Casz1	UTSW	4	148941704	missense	possibly damaging	0.89
R6354:Casz1	UTSW	4	148952542	missense	unknown
R6454:Casz1	UTSW	4	148951495	missense	probably damaging	0.99
R6479:Casz1	UTSW	4	148937078	missense	probably damaging	1.00
R6529:Casz1	UTSW	4	148938189	missense	probably damaging	1.00
R6772:Casz1	UTSW	4	148943206	missense	probably damaging	1.00
R7000:Casz1	UTSW	4	148929236	missense	probably damaging	1.00
R7152:Casz1	UTSW	4	148901291	start gained	probably benign
R7324:Casz1	UTSW	4	148947033	missense	probably damaging	0.99
R7339:Casz1	UTSW	4	148951745	missense	probably damaging	1.00
R7388:Casz1	UTSW	4	148952393	missense	unknown
R7480:Casz1	UTSW	4	148944586	missense	probably damaging	0.99
R7719:Casz1	UTSW	4	148944524	missense	probably damaging	0.99
R7789:Casz1	UTSW	4	148929406	missense	probably benign
R7801:Casz1	UTSW	4	148938249	missense	probably damaging	0.99
R7815:Casz1	UTSW	4	148929305	missense	possibly damaging	0.89
R7818:Casz1	UTSW	4	148946076	missense	probably damaging	1.00
R7938:Casz1	UTSW	4	148944486	missense	probably benign	0.05
R8045:Casz1	UTSW	4	148932779	missense	probably damaging	1.00
R8134:Casz1	UTSW	4	148943035	missense	probably damaging	1.00
R8165:Casz1	UTSW	4	148944431	missense	probably damaging	1.00
R8301:Casz1	UTSW	4	148946043	missense	probably damaging	0.98
R9047:Casz1	UTSW	4	148939040	missense	probably damaging	1.00
R9420:Casz1	UTSW	4	148938863	missense	probably damaging	0.99
R9584:Casz1	UTSW	4	148901247	start gained	probably benign
RF001:Casz1	UTSW	4	148952304	small deletion	probably benign
RF063:Casz1	UTSW	4	148952304	small deletion	probably benign
X0018:Casz1	UTSW	4	148939008	missense	probably damaging	1.00
X0064:Casz1	UTSW	4	148932952	missense	probably damaging	0.99
Z1088:Casz1	UTSW	4	148944359	missense	probably benign
Z1176:Casz1	UTSW	4	148944359	missense	probably benign
Z1177:Casz1	UTSW	4	148933306	missense	probably damaging	1.00
Z1177:Casz1	UTSW	4	148944359	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAGCTAGTTAGAGGTATTCCCC -3'
(R):5'- TGTCTCGGCATCCATTAGGC -3'

Sequencing Primer
(F):5'- TTAGAGGTATTCCCCCGGATGC -3'
(R):5'- GCCCTAAGGTAGTAGCCCAC -3'

Posted On

2020-10-20