Incidental Mutation 'R8672:Ints5'
ID661233
Institutional Source Beutler Lab
Gene Symbol Ints5
Ensembl Gene ENSMUSG00000116347
Gene Name
Synonyms1110055N21Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.520) question?
Stock #R8672 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8888926-8895227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8896006 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 443 (L443Q)
Ref Sequence ENSEMBL: ENSMUSP00000093968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096246] [ENSMUST00000096249] [ENSMUST00000187504] [ENSMUST00000191089]
Predicted Effect probably benign
Transcript: ENSMUST00000096246
SMART Domains Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
Pfam:Gal_mutarotas_2 275 346 3.9e-24 PFAM
Pfam:Glyco_hydro_31 387 832 8.7e-136 PFAM
low complexity region 888 898 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000096249
AA Change: L443Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093968
Gene: ENSMUSG00000071652
AA Change: L443Q

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:INTS5_N 29 252 1e-82 PFAM
low complexity region 254 267 N/A INTRINSIC
Pfam:INTS5_C 289 998 2.2e-249 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187504
SMART Domains Protein: ENSMUSP00000139692
Gene: ENSMUSG00000096740

DomainStartEndE-ValueType
Pfam:Lbh 1 101 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191089
SMART Domains Protein: ENSMUSP00000140564
Gene: ENSMUSG00000116347

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Integrator complex is a complex that associates with the C-terminal domain of RNA polymerase II large subunit. This complex is brought to U1 and U2 small nuclear RNA genes, where it is involved in the transcription and processing of their transcripts. The protein encoded by this gene represents a subunit of the Integrator complex. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932415D10Rik A T 10: 82,291,892 N1761K probably benign Het
9930021J03Rik T C 19: 29,754,164 T483A probably benign Het
Aadat A T 8: 60,506,145 probably benign Het
Amigo3 A G 9: 108,054,176 H266R possibly damaging Het
Amy2a1 A T 3: 113,529,497 M214K probably damaging Het
Atp11b A T 3: 35,819,917 D685V probably benign Het
Aunip T A 4: 134,523,149 M135K probably benign Het
Card9 T C 2: 26,357,938 T134A probably benign Het
Cd46 G A 1: 195,082,641 T216I probably benign Het
Chit1 T C 1: 134,151,267 V360A unknown Het
Crcp A G 5: 130,042,236 R59G probably benign Het
Csmd1 T A 8: 15,926,598 E2873D probably benign Het
Cyp8b1 T A 9: 121,914,920 M449L probably benign Het
Dpp7 T C 2: 25,356,121 D40G probably benign Het
Eif4g3 T A 4: 138,126,512 L463Q possibly damaging Het
Fzd9 T C 5: 135,249,670 I454V probably benign Het
Gbp11 T A 5: 105,343,809 I41F probably damaging Het
Gkap1 G A 13: 58,243,848 T231I probably damaging Het
Heatr5b A G 17: 78,762,203 L1705P probably damaging Het
Herc3 T A 6: 58,873,801 F467I probably damaging Het
Ifih1 T C 2: 62,605,649 E699G possibly damaging Het
Itpr2 A T 6: 146,374,518 C764S probably damaging Het
Kcnma1 A T 14: 23,501,162 I519N probably damaging Het
Krtap4-1 C T 11: 99,628,064 C40Y unknown Het
Mdn1 A G 4: 32,768,793 D5384G probably damaging Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mucl1 A G 15: 103,753,797 S48P possibly damaging Het
Musk T G 4: 58,286,051 probably benign Het
Nemp1 T C 10: 127,677,119 S8P probably benign Het
Nisch A G 14: 31,173,136 C1068R probably damaging Het
Npr3 T C 15: 11,851,493 N404D probably damaging Het
Nwd1 C G 8: 72,667,379 H423Q probably damaging Het
Olfr1062 T A 2: 86,423,632 M15L probably benign Het
Olfr76 C T 19: 12,120,557 V52M probably benign Het
Olfr792 T A 10: 129,540,727 N63K probably damaging Het
Pcdh9 T C 14: 93,887,093 N547S probably benign Het
Pdha2 C A 3: 141,211,363 R128L probably damaging Het
Pebp1 A G 5: 117,283,271 Y181H probably benign Het
Peg3 T G 7: 6,708,524 D1233A possibly damaging Het
Pepd C A 7: 34,942,682 T146N probably damaging Het
Ptk2b A T 14: 66,156,392 D877E probably benign Het
Rabgap1l A C 1: 160,443,276 M647R probably damaging Het
Rp1 A G 1: 4,348,784 S702P possibly damaging Het
Shb A T 4: 45,489,161 D238E probably damaging Het
Slc36a1 T A 11: 55,232,508 V433D possibly damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Tcerg1 A T 18: 42,553,494 K705N probably damaging Het
Thbs1 C A 2: 118,113,238 N112K probably benign Het
Zfp658 T C 7: 43,573,495 I398T possibly damaging Het
Other mutations in Ints5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Ints5 APN 19 8895487 missense possibly damaging 0.93
IGL01915:Ints5 APN 19 8896993 missense probably benign
IGL01993:Ints5 APN 19 8895465 missense probably benign
IGL02264:Ints5 APN 19 8895712 missense probably benign 0.02
IGL02367:Ints5 APN 19 8895595 missense probably benign 0.06
IGL02955:Ints5 APN 19 8897650 missense probably damaging 1.00
FR4449:Ints5 UTSW 19 8897230 missense probably benign 0.10
R0348:Ints5 UTSW 19 8895750 missense probably damaging 0.97
R0379:Ints5 UTSW 19 8897133 missense possibly damaging 0.90
R0617:Ints5 UTSW 19 8896019 missense probably damaging 1.00
R1954:Ints5 UTSW 19 8894896 missense probably damaging 1.00
R2172:Ints5 UTSW 19 8896282 missense possibly damaging 0.73
R2370:Ints5 UTSW 19 8896779 missense probably benign
R3116:Ints5 UTSW 19 8894772 missense possibly damaging 0.84
R4395:Ints5 UTSW 19 8896444 missense probably damaging 0.96
R5390:Ints5 UTSW 19 8896567 missense possibly damaging 0.73
R6868:Ints5 UTSW 19 8897386 missense probably damaging 1.00
R7133:Ints5 UTSW 19 8895559 missense probably damaging 1.00
R7685:Ints5 UTSW 19 8896804 missense probably benign 0.10
R7999:Ints5 UTSW 19 8897043 missense probably benign
R8024:Ints5 UTSW 19 8896140 missense probably damaging 1.00
R8296:Ints5 UTSW 19 8895120 missense probably damaging 1.00
X0066:Ints5 UTSW 19 8896231 missense probably damaging 1.00
Z1177:Ints5 UTSW 19 8894935 missense probably benign 0.31
Z1177:Ints5 UTSW 19 8894973 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACCTGGCTGTGCATCTAG -3'
(R):5'- AGTAGATGACCCAAGGCCTC -3'

Sequencing Primer
(F):5'- CTGTGCATCTAGTGAGCCAG -3'
(R):5'- TCCACAGCTAGGTCGTGTATAGAC -3'
Posted On2021-03-08