Incidental Mutation 'R8672:Pepd'
ID661211
Institutional Source Beutler Lab
Gene Symbol Pepd
Ensembl Gene ENSMUSG00000063931
Gene Namepeptidase D
SynonymsPep4, Pep-4, dal, peptidase D
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8672 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location34912379-35044708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34942682 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 146 (T146N)
Ref Sequence ENSEMBL: ENSMUSP00000075683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075068]
Predicted Effect probably damaging
Transcript: ENSMUST00000075068
AA Change: T146N

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075683
Gene: ENSMUSG00000063931
AA Change: T146N

DomainStartEndE-ValueType
AMP_N 18 155 2.71e-39 SMART
Pfam:Peptidase_M24 193 459 5.4e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161900
SMART Domains Protein: ENSMUSP00000133634
Gene: ENSMUSG00000063931

DomainStartEndE-ValueType
Blast:AMP_N 2 35 3e-15 BLAST
PDB:2OKN|B 2 76 1e-43 PDB
SCOP:d1b6a_2 7 77 2e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase family. The protein forms a homodimer that hydrolyzes dipeptides or tripeptides with C-terminal proline or hydroxyproline residues. The enzyme serves an important role in the recycling of proline, and may be rate limiting for the production of collagen. Mutations in this gene result in prolidase deficiency, which is characterized by the excretion of large amount of di- and tri-peptides containing proline. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants are smaller than normal siblings and, except on the flanks, an agouti coat appears nonagouti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932415D10Rik A T 10: 82,291,892 N1761K probably benign Het
9930021J03Rik T C 19: 29,754,164 T483A probably benign Het
Aadat A T 8: 60,506,145 probably benign Het
Amigo3 A G 9: 108,054,176 H266R possibly damaging Het
Amy2a1 A T 3: 113,529,497 M214K probably damaging Het
Atp11b A T 3: 35,819,917 D685V probably benign Het
Aunip T A 4: 134,523,149 M135K probably benign Het
Card9 T C 2: 26,357,938 T134A probably benign Het
Cd46 G A 1: 195,082,641 T216I probably benign Het
Chit1 T C 1: 134,151,267 V360A unknown Het
Crcp A G 5: 130,042,236 R59G probably benign Het
Csmd1 T A 8: 15,926,598 E2873D probably benign Het
Cyp8b1 T A 9: 121,914,920 M449L probably benign Het
Dpp7 T C 2: 25,356,121 D40G probably benign Het
Eif4g3 T A 4: 138,126,512 L463Q possibly damaging Het
Fzd9 T C 5: 135,249,670 I454V probably benign Het
Gbp11 T A 5: 105,343,809 I41F probably damaging Het
Gkap1 G A 13: 58,243,848 T231I probably damaging Het
Heatr5b A G 17: 78,762,203 L1705P probably damaging Het
Herc3 T A 6: 58,873,801 F467I probably damaging Het
Ifih1 T C 2: 62,605,649 E699G possibly damaging Het
Ints5 T A 19: 8,896,006 L443Q probably damaging Het
Itpr2 A T 6: 146,374,518 C764S probably damaging Het
Kcnma1 A T 14: 23,501,162 I519N probably damaging Het
Krtap4-1 C T 11: 99,628,064 C40Y unknown Het
Mdn1 A G 4: 32,768,793 D5384G probably damaging Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mucl1 A G 15: 103,753,797 S48P possibly damaging Het
Musk T G 4: 58,286,051 probably benign Het
Nemp1 T C 10: 127,677,119 S8P probably benign Het
Nisch A G 14: 31,173,136 C1068R probably damaging Het
Npr3 T C 15: 11,851,493 N404D probably damaging Het
Nwd1 C G 8: 72,667,379 H423Q probably damaging Het
Olfr1062 T A 2: 86,423,632 M15L probably benign Het
Olfr76 C T 19: 12,120,557 V52M probably benign Het
Olfr792 T A 10: 129,540,727 N63K probably damaging Het
Pcdh9 T C 14: 93,887,093 N547S probably benign Het
Pdha2 C A 3: 141,211,363 R128L probably damaging Het
Pebp1 A G 5: 117,283,271 Y181H probably benign Het
Peg3 T G 7: 6,708,524 D1233A possibly damaging Het
Ptk2b A T 14: 66,156,392 D877E probably benign Het
Rabgap1l A C 1: 160,443,276 M647R probably damaging Het
Rp1 A G 1: 4,348,784 S702P possibly damaging Het
Shb A T 4: 45,489,161 D238E probably damaging Het
Slc36a1 T A 11: 55,232,508 V433D possibly damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Tcerg1 A T 18: 42,553,494 K705N probably damaging Het
Thbs1 C A 2: 118,113,238 N112K probably benign Het
Zfp658 T C 7: 43,573,495 I398T possibly damaging Het
Other mutations in Pepd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pepd APN 7 34924440 missense probably benign
IGL02102:Pepd APN 7 34945603 missense probably damaging 1.00
R1256:Pepd UTSW 7 34921492 missense possibly damaging 0.95
R1690:Pepd UTSW 7 35031357 missense probably damaging 1.00
R1734:Pepd UTSW 7 35031426 missense probably benign 0.07
R1911:Pepd UTSW 7 34934749 splice site probably benign
R1918:Pepd UTSW 7 34971676 missense probably benign 0.00
R2144:Pepd UTSW 7 34921418 missense probably benign 0.09
R4814:Pepd UTSW 7 34945597 missense probably damaging 0.96
R4924:Pepd UTSW 7 35020984 missense probably benign 0.24
R5490:Pepd UTSW 7 34942690 splice site probably null
R5669:Pepd UTSW 7 35040674 missense probably benign 0.38
R6240:Pepd UTSW 7 35021751 missense probably benign 0.00
R6300:Pepd UTSW 7 34969543 missense probably damaging 1.00
R6479:Pepd UTSW 7 35040722 missense probably benign 0.00
R6995:Pepd UTSW 7 35021719 missense probably damaging 1.00
R7303:Pepd UTSW 7 35021772 critical splice donor site probably null
R7587:Pepd UTSW 7 34969540 missense probably damaging 1.00
R8008:Pepd UTSW 7 35021701 missense probably benign 0.22
R8815:Pepd UTSW 7 34971691 missense probably damaging 1.00
X0021:Pepd UTSW 7 34954563 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGTGGTGGAGCACAAGAGC -3'
(R):5'- GTGTCCTTACTCACCACAGG -3'

Sequencing Primer
(F):5'- AGAGCTCCCGTCACAGCAG -3'
(R):5'- ACAGGTGACCAGTTCTCAGC -3'
Posted On2021-03-08