Incidental Mutation 'R8823:Xpo1'
ID 673286
Institutional Source Beutler Lab
Gene Symbol Xpo1
Ensembl Gene ENSMUSG00000020290
Gene Name exportin 1
Synonyms Crm1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8823 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 23256041-23298249 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23267752 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 73 (M73L)
Ref Sequence ENSEMBL: ENSMUSP00000105178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020538] [ENSMUST00000102869] [ENSMUST00000102870] [ENSMUST00000109551] [ENSMUST00000136235]
AlphaFold Q6P5F9
PDB Structure Crystal Structure of the Nuclear Export Complex CRM1-Snurportin1-RanGTP [X-RAY DIFFRACTION]
Crystal structure of the PKI NES-CRM1-RanGTP nuclear export complex [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal I) [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal II) [X-RAY DIFFRACTION]
Crystal structure of the CRM1-RanGTP complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020538
AA Change: M73L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020538
Gene: ENSMUSG00000020290
AA Change: M73L

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102869
AA Change: M73L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099933
Gene: ENSMUSG00000020290
AA Change: M73L

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 7.4e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102870
AA Change: M73L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099934
Gene: ENSMUSG00000020290
AA Change: M73L

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109551
AA Change: M73L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105178
Gene: ENSMUSG00000020290
AA Change: M73L

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136235
SMART Domains Protein: ENSMUSP00000123634
Gene: ENSMUSG00000020290

DomainStartEndE-ValueType
PDB:4BSN|A 1 59 4e-35 PDB
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 T A 8: 40,680,189 I232K probably benign Het
Ap5z1 T C 5: 142,474,436 L506P probably benign Het
Ceacam20 A T 7: 19,971,504 Y140F probably damaging Het
Chfr G A 5: 110,152,392 R334H probably damaging Het
Emx2 A G 19: 59,459,448 H78R probably damaging Het
Etnppl G A 3: 130,626,546 G204R probably damaging Het
Fah A G 7: 84,605,717 F3L possibly damaging Het
Galnt12 G T 4: 47,091,928 probably benign Het
Gbx1 A G 5: 24,505,053 S265P probably damaging Het
Gm17087 A G 17: 8,566,401 *157R probably null Het
Gm5426 A T 10: 96,136,771 I57F possibly damaging Het
Grin2a T A 16: 9,669,894 N380I possibly damaging Het
Grip1 C T 10: 119,975,951 T269I Het
Hace1 T C 10: 45,648,860 Y241H probably damaging Het
Hrc A G 7: 45,336,298 D291G possibly damaging Het
Ifi208 A G 1: 173,683,536 Y419C probably damaging Het
Ighv8-5 A G 12: 115,067,647 S91P probably damaging Het
Igkv15-103 T C 6: 68,437,871 L98P probably damaging Het
Igsf5 C T 16: 96,421,739 S61L possibly damaging Het
Ipo9 A G 1: 135,419,339 W138R probably damaging Het
Kank4 A T 4: 98,780,003 L69Q probably damaging Het
Kcnd3 T C 3: 105,667,014 I505T probably benign Het
Lrtm2 T A 6: 119,317,232 I313F probably damaging Het
Mug2 A T 6: 122,063,689 I733F possibly damaging Het
Myh2 A T 11: 67,185,474 R800S probably damaging Het
Myo1d A T 11: 80,601,745 I728N possibly damaging Het
Olfr519 A G 7: 108,893,948 I158T probably benign Het
Pdcd1 T C 1: 94,041,495 R33G probably benign Het
Polr1b T C 2: 129,125,537 F950S probably damaging Het
Prpf8 T A 11: 75,493,456 M697K probably benign Het
Psmc2 T A 5: 21,800,576 D218E probably damaging Het
Ptpn12 A G 5: 20,998,623 Y386H probably damaging Het
Rilpl2 C T 5: 124,468,653 R166K possibly damaging Het
Rtn4 T A 11: 29,706,609 N254K probably benign Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sesn3 T A 9: 14,310,240 probably benign Het
Slc35b2 T A 17: 45,566,968 H291Q probably damaging Het
Slc38a3 A C 9: 107,655,951 Y308D probably damaging Het
Snrpd2 T C 7: 19,152,610 V106A probably benign Het
Sybu C A 15: 44,677,602 A355S possibly damaging Het
Tes3-ps A T 13: 49,494,216 R189S probably benign Het
Trmo T C 4: 46,382,604 D164G probably damaging Het
Vmn1r225 A G 17: 20,502,561 Q88R probably benign Het
Xkr9 T C 1: 13,672,608 V39A probably benign Het
Zbtb21 G A 16: 97,951,316 T589I probably damaging Het
Zbtb41 A G 1: 139,423,154 K2E probably damaging Het
Zfp105 A G 9: 122,930,503 K413R possibly damaging Het
Other mutations in Xpo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Xpo1 APN 11 23285094 missense probably damaging 1.00
IGL01464:Xpo1 APN 11 23267703 missense probably damaging 0.97
IGL01561:Xpo1 APN 11 23282706 missense possibly damaging 0.76
IGL01630:Xpo1 APN 11 23285846 missense probably benign 0.00
IGL01700:Xpo1 APN 11 23276422 splice site probably benign
IGL02000:Xpo1 APN 11 23296003 missense probably damaging 1.00
IGL02299:Xpo1 APN 11 23293915 splice site probably benign
IGL02313:Xpo1 APN 11 23277065 missense probably damaging 1.00
IGL02828:Xpo1 APN 11 23282593 missense probably damaging 0.97
IGL03210:Xpo1 APN 11 23278834 missense probably benign 0.01
IGL03329:Xpo1 APN 11 23284306 missense probably benign
PIT1430001:Xpo1 UTSW 11 23276437 missense possibly damaging 0.66
R0507:Xpo1 UTSW 11 23294682 missense possibly damaging 0.61
R0594:Xpo1 UTSW 11 23280402 missense probably damaging 1.00
R0706:Xpo1 UTSW 11 23280441 missense probably benign 0.09
R0742:Xpo1 UTSW 11 23294682 missense possibly damaging 0.61
R1385:Xpo1 UTSW 11 23261863 missense probably damaging 0.96
R1478:Xpo1 UTSW 11 23291623 missense probably damaging 0.99
R1483:Xpo1 UTSW 11 23284863 missense probably benign 0.04
R1694:Xpo1 UTSW 11 23281399 missense probably benign 0.12
R1775:Xpo1 UTSW 11 23271193 missense probably benign
R1827:Xpo1 UTSW 11 23285155 missense probably benign 0.00
R2262:Xpo1 UTSW 11 23284634 splice site probably null
R2263:Xpo1 UTSW 11 23284634 splice site probably null
R4510:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4511:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4840:Xpo1 UTSW 11 23278183 missense probably damaging 1.00
R4901:Xpo1 UTSW 11 23281327 missense possibly damaging 0.62
R5176:Xpo1 UTSW 11 23295977 missense probably damaging 0.99
R5508:Xpo1 UTSW 11 23294645 missense probably benign
R5927:Xpo1 UTSW 11 23268653 unclassified probably benign
R5927:Xpo1 UTSW 11 23268656 unclassified probably benign
R6110:Xpo1 UTSW 11 23287434 missense probably damaging 0.99
R6421:Xpo1 UTSW 11 23291490 missense possibly damaging 0.60
R6591:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6691:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6698:Xpo1 UTSW 11 23294040 missense probably benign 0.01
R6958:Xpo1 UTSW 11 23285855 missense probably benign
R7407:Xpo1 UTSW 11 23285823 missense probably damaging 1.00
R7482:Xpo1 UTSW 11 23282544 missense probably benign 0.00
R7624:Xpo1 UTSW 11 23282584 missense probably damaging 0.99
R8335:Xpo1 UTSW 11 23280603 splice site probably null
R9128:Xpo1 UTSW 11 23285058 missense probably damaging 1.00
R9232:Xpo1 UTSW 11 23282646 missense probably benign
R9277:Xpo1 UTSW 11 23291550 missense probably benign 0.17
Z1176:Xpo1 UTSW 11 23296080 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTAACTGGTACATTTCTCACATG -3'
(R):5'- ACCTTGCACTCTAGTCCCAG -3'

Sequencing Primer
(F):5'- AAGTATCACTTCACTGTGTTGTTAGG -3'
(R):5'- TGCACTCTAGTCCCAGTTATAAAAAC -3'
Posted On 2021-07-15