Incidental Mutation 'R8823:Mug2'
ID673274
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Namemurinoglobulin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R8823 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location122006761-122085965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122063689 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 733 (I733F)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081777
AA Change: I733F

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: I733F

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 T A 8: 40,680,189 I232K probably benign Het
Ap5z1 T C 5: 142,474,436 L506P probably benign Het
Ceacam20 A T 7: 19,971,504 Y140F probably damaging Het
Chfr G A 5: 110,152,392 R334H probably damaging Het
Emx2 A G 19: 59,459,448 H78R probably damaging Het
Etnppl G A 3: 130,626,546 G204R probably damaging Het
Fah A G 7: 84,605,717 F3L possibly damaging Het
Galnt12 G T 4: 47,091,928 probably benign Het
Gbx1 A G 5: 24,505,053 S265P probably damaging Het
Gm17087 A G 17: 8,566,401 *157R probably null Het
Gm5426 A T 10: 96,136,771 I57F possibly damaging Het
Grin2a T A 16: 9,669,894 N380I possibly damaging Het
Grip1 C T 10: 119,975,951 T269I Het
Hace1 T C 10: 45,648,860 Y241H probably damaging Het
Hrc A G 7: 45,336,298 D291G possibly damaging Het
Ifi208 A G 1: 173,683,536 Y419C probably damaging Het
Ighv8-5 A G 12: 115,067,647 S91P probably damaging Het
Igkv15-103 T C 6: 68,437,871 L98P probably damaging Het
Igsf5 C T 16: 96,421,739 S61L possibly damaging Het
Ipo9 A G 1: 135,419,339 W138R probably damaging Het
Kank4 A T 4: 98,780,003 L69Q probably damaging Het
Kcnd3 T C 3: 105,667,014 I505T probably benign Het
Lrtm2 T A 6: 119,317,232 I313F probably damaging Het
Myh2 A T 11: 67,185,474 R800S probably damaging Het
Myo1d A T 11: 80,601,745 I728N possibly damaging Het
Olfr519 A G 7: 108,893,948 I158T probably benign Het
Pdcd1 T C 1: 94,041,495 R33G probably benign Het
Polr1b T C 2: 129,125,537 F950S probably damaging Het
Prpf8 T A 11: 75,493,456 M697K probably benign Het
Psmc2 T A 5: 21,800,576 D218E probably damaging Het
Ptpn12 A G 5: 20,998,623 Y386H probably damaging Het
Rilpl2 C T 5: 124,468,653 R166K possibly damaging Het
Rtn4 T A 11: 29,706,609 N254K probably benign Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc35b2 T A 17: 45,566,968 H291Q probably damaging Het
Slc38a3 A C 9: 107,655,951 Y308D probably damaging Het
Snrpd2 T C 7: 19,152,610 V106A probably benign Het
Sybu C A 15: 44,677,602 A355S possibly damaging Het
Tes3-ps A T 13: 49,494,216 R189S probably benign Het
Trmo T C 4: 46,382,604 D164G probably damaging Het
Vmn1r225 A G 17: 20,502,561 Q88R probably benign Het
Xkr9 T C 1: 13,672,608 V39A probably benign Het
Xpo1 A T 11: 23,267,752 M73L probably benign Het
Zbtb21 G A 16: 97,951,316 T589I probably damaging Het
Zbtb41 A G 1: 139,423,154 K2E probably damaging Het
Zfp105 A G 9: 122,930,503 K413R possibly damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0119:Mug2 UTSW 6 122036063 missense probably benign 0.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122071011 splice site probably benign
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1104:Mug2 UTSW 6 122059055 missense probably benign
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4227:Mug2 UTSW 6 122040732 missense probably benign 0.10
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4419:Mug2 UTSW 6 122079630 missense probably damaging 1.00
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122047487 missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7581:Mug2 UTSW 6 122063711 missense probably damaging 1.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7834:Mug2 UTSW 6 122036282 missense probably benign
R7850:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R8029:Mug2 UTSW 6 122081545 critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122075608 missense probably benign 0.01
R8335:Mug2 UTSW 6 122040584 missense probably benign
R8348:Mug2 UTSW 6 122072233 nonsense probably null
R8557:Mug2 UTSW 6 122063701 missense probably damaging 0.99
R8798:Mug2 UTSW 6 122081610 missense probably damaging 1.00
Z1177:Mug2 UTSW 6 122037121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTACACCACTATGTTCCATTG -3'
(R):5'- ATTTTAACTATCAGGCAGGTACGTG -3'

Sequencing Primer
(F):5'- ACACCACTATGTTCCATTGAATTC -3'
(R):5'- CAGGCAGGTACGTGATAGTTTTTATG -3'
Posted On2021-07-15