Incidental Mutation 'R0594:Xpo1'
Institutional Source Beutler Lab
Gene Symbol Xpo1
Ensembl Gene ENSMUSG00000020290
Gene Nameexportin 1
MMRRC Submission 038784-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0594 (G1)
Quality Score214
Status Validated
Chromosomal Location23256041-23298249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23280402 bp
Amino Acid Change Valine to Glutamic Acid at position 263 (V263E)
Ref Sequence ENSEMBL: ENSMUSP00000105178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020538] [ENSMUST00000102869] [ENSMUST00000102870] [ENSMUST00000109551]
PDB Structure Crystal Structure of the Nuclear Export Complex CRM1-Snurportin1-RanGTP [X-RAY DIFFRACTION]
Crystal structure of the PKI NES-CRM1-RanGTP nuclear export complex [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal I) [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal II) [X-RAY DIFFRACTION]
Crystal structure of the CRM1-RanGTP complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000020538
AA Change: V263E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020538
Gene: ENSMUSG00000020290
AA Change: V263E

IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102869
AA Change: V263E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099933
Gene: ENSMUSG00000020290
AA Change: V263E

IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 7.4e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102870
AA Change: V263E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099934
Gene: ENSMUSG00000020290
AA Change: V263E

IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109551
AA Change: V263E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105178
Gene: ENSMUSG00000020290
AA Change: V263E

IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149371
Predicted Effect probably benign
Transcript: ENSMUST00000150750
SMART Domains Protein: ENSMUSP00000117846
Gene: ENSMUSG00000020290

Blast:CRM1_C 97 136 3e-8 BLAST
Pfam:CRM1_C 171 233 4.3e-22 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 99% (119/120)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,389,880 V41A probably benign Het
Acad11 A G 9: 104,095,563 Q367R probably benign Het
Ackr4 A G 9: 104,099,004 V248A possibly damaging Het
Adamts14 T C 10: 61,202,887 E945G probably damaging Het
Akap2 A G 4: 57,856,752 T694A probably benign Het
Ano2 A G 6: 125,982,765 M663V probably damaging Het
Apc2 T A 10: 80,306,256 C336* probably null Het
Arhgap17 A G 7: 123,294,518 S560P probably benign Het
Arl5a T C 2: 52,405,014 D128G probably damaging Het
Atp6v0a2 C A 5: 124,717,982 R678S probably benign Het
B4galnt2 C A 11: 95,891,909 A26S probably benign Het
C1qtnf1 A T 11: 118,446,628 T95S possibly damaging Het
Ccdc188 T A 16: 18,218,920 F241L probably benign Het
Cdh19 A T 1: 110,925,867 D281E probably benign Het
Cdk5rap2 T C 4: 70,354,813 E241G probably damaging Het
Cherp A T 8: 72,462,402 probably null Het
Cpne9 T A 6: 113,290,400 probably benign Het
Cthrc1 A T 15: 39,077,142 R47W possibly damaging Het
Dcaf13 A G 15: 39,123,268 E145G probably benign Het
Dcaf4 T A 12: 83,538,043 probably null Het
Dgka A C 10: 128,733,110 probably benign Het
Dhrs13 T A 11: 78,034,525 F157L probably damaging Het
Dnajb5 A T 4: 42,956,577 Y88F probably damaging Het
Dpp8 A G 9: 65,036,998 T16A probably damaging Het
Dscc1 A T 15: 55,089,052 I91K possibly damaging Het
Efemp2 T A 19: 5,475,063 probably benign Het
Elf2 T C 3: 51,256,453 T504A possibly damaging Het
Elk3 G A 10: 93,265,160 S243F probably damaging Het
Ell2 A G 13: 75,749,993 D93G probably damaging Het
Eln G T 5: 134,712,398 probably benign Het
Eme1 C T 11: 94,650,430 D189N possibly damaging Het
Epb41l2 A G 10: 25,443,770 E167G possibly damaging Het
Exoc5 A T 14: 49,036,087 probably benign Het
Fam129c C A 8: 71,599,135 A38E probably benign Het
Fam170b A G 14: 32,836,314 K369E unknown Het
Fam187b T A 7: 30,977,154 C29* probably null Het
Fam20c T C 5: 138,766,637 S260P possibly damaging Het
Fam216b G A 14: 78,086,674 A21V possibly damaging Het
Fam98a A T 17: 75,538,487 Y421* probably null Het
Farp2 T C 1: 93,576,500 V333A probably damaging Het
Fcgr1 T C 3: 96,292,312 Y93C probably damaging Het
Fgd2 A T 17: 29,365,552 I157F probably damaging Het
Frmd4b T A 6: 97,325,426 probably benign Het
Fut9 T C 4: 25,620,526 D96G possibly damaging Het
Glt8d1 G A 14: 31,010,410 probably null Het
Gm7579 T A 7: 142,212,384 C176S unknown Het
Gmpr2 A G 14: 55,677,988 E272G probably damaging Het
Grin2b T C 6: 135,733,929 H873R probably damaging Het
Gtf2i C T 5: 134,242,173 probably benign Het
Htr3b A T 9: 48,947,631 V69E probably benign Het
Icam5 A G 9: 21,035,598 N474S probably benign Het
Itgal T A 7: 127,314,060 S610T probably damaging Het
Jag1 T A 2: 137,087,080 I819L probably damaging Het
Kif9 A T 9: 110,511,340 E467V probably benign Het
Krit1 T C 5: 3,823,694 L491P possibly damaging Het
Lipo2 T G 19: 33,746,902 I155L possibly damaging Het
Lmbr1 A G 5: 29,292,209 F65L possibly damaging Het
Lsp1 G A 7: 142,488,950 probably benign Het
Marc2 T C 1: 184,841,339 N121D probably benign Het
Mgat5 T A 1: 127,412,248 D455E probably damaging Het
Mical2 A T 7: 112,318,450 Y338F probably damaging Het
Mkl1 G A 15: 81,017,174 T372I probably damaging Het
Mre11a T G 9: 14,815,209 S396A probably benign Het
Myo3a C T 2: 22,544,332 probably benign Het
Naca T C 10: 128,040,355 probably benign Het
Nav1 A T 1: 135,467,643 I996K possibly damaging Het
Ncbp1 A G 4: 46,170,551 N742S probably benign Het
Ndufaf3 G A 9: 108,566,923 A2V probably benign Het
Ntn5 G T 7: 45,686,681 A47S probably damaging Het
Olfr1122 T A 2: 87,387,954 I83N probably damaging Het
Olfr13 T A 6: 43,174,607 V207E possibly damaging Het
Olfr1502 G T 19: 13,862,279 C162F probably benign Het
Olfr384 G A 11: 73,603,392 E271K probably benign Het
Olfr392 T C 11: 73,814,617 H155R probably benign Het
Olfr777 T C 10: 129,269,152 Y57C possibly damaging Het
Otud7a T A 7: 63,727,472 L203* probably null Het
Pcdhb13 A G 18: 37,443,931 Y454C probably damaging Het
Pdzph1 C T 17: 58,954,479 V853M possibly damaging Het
Plec A G 15: 76,172,253 S4517P probably damaging Het
Pm20d2 C T 4: 33,181,746 E286K probably damaging Het
Polr2i T A 7: 30,232,745 probably null Het
Ppp1r12b A G 1: 134,776,479 L879P probably damaging Het
Prf1 C A 10: 61,303,722 Y486* probably null Het
Qsox2 T G 2: 26,214,044 T325P probably damaging Het
Rab1b G T 19: 5,100,656 probably benign Het
Rbm19 T C 5: 120,128,316 probably null Het
Rhobtb2 A G 14: 69,793,948 V576A probably benign Het
Rnps1 G A 17: 24,424,437 V215M probably damaging Het
Rps11 A G 7: 45,124,282 probably benign Het
Serpinb3d C T 1: 107,079,347 M210I probably damaging Het
Sgsm1 T C 5: 113,310,562 T17A probably benign Het
Slc6a3 A G 13: 73,538,642 T43A probably damaging Het
Sox4 C G 13: 28,952,904 A40P probably damaging Het
Spry2 A T 14: 105,893,310 D147E possibly damaging Het
Stpg1 A G 4: 135,519,431 N157D possibly damaging Het
Sumf1 T C 6: 108,173,414 D152G probably benign Het
Tbr1 T C 2: 61,811,620 S410P possibly damaging Het
Tdrd6 A G 17: 43,629,383 V258A probably damaging Het
Tirap C T 9: 35,188,761 G209D probably damaging Het
Tnfrsf8 A T 4: 145,296,861 V134D probably damaging Het
Tnr A G 1: 159,850,335 T97A probably benign Het
Tspan32 T A 7: 143,015,610 F135L probably damaging Het
Ttn T C 2: 76,789,056 K16021E probably damaging Het
Tusc3 T A 8: 39,096,968 I251N probably damaging Het
Usp38 A T 8: 81,005,366 I305N probably damaging Het
Usp4 T A 9: 108,370,881 probably null Het
Usp5 A T 6: 124,817,424 D764E probably damaging Het
Vangl2 A T 1: 172,004,657 V544E probably damaging Het
Vldlr G A 19: 27,234,819 V78M probably damaging Het
Vmn1r29 T C 6: 58,307,772 V159A probably benign Het
Vmn2r16 T A 5: 109,363,896 F656L probably damaging Het
Wdfy3 T A 5: 101,906,185 I1590F possibly damaging Het
Zbtb38 A G 9: 96,685,954 S1026P probably damaging Het
Zfp407 A T 18: 84,562,567 D140E possibly damaging Het
Zfp637 T A 6: 117,845,686 Y258* probably null Het
Zfp951 T A 5: 104,814,572 Q376L possibly damaging Het
Other mutations in Xpo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Xpo1 APN 11 23285094 missense probably damaging 1.00
IGL01464:Xpo1 APN 11 23267703 missense probably damaging 0.97
IGL01561:Xpo1 APN 11 23282706 missense possibly damaging 0.76
IGL01630:Xpo1 APN 11 23285846 missense probably benign 0.00
IGL01700:Xpo1 APN 11 23276422 splice site probably benign
IGL02000:Xpo1 APN 11 23296003 missense probably damaging 1.00
IGL02299:Xpo1 APN 11 23293915 splice site probably benign
IGL02313:Xpo1 APN 11 23277065 missense probably damaging 1.00
IGL02828:Xpo1 APN 11 23282593 missense probably damaging 0.97
IGL03210:Xpo1 APN 11 23278834 missense probably benign 0.01
IGL03329:Xpo1 APN 11 23284306 missense probably benign
PIT1430001:Xpo1 UTSW 11 23276437 missense possibly damaging 0.66
R0507:Xpo1 UTSW 11 23294682 missense possibly damaging 0.61
R0706:Xpo1 UTSW 11 23280441 missense probably benign 0.09
R0742:Xpo1 UTSW 11 23294682 missense possibly damaging 0.61
R1385:Xpo1 UTSW 11 23261863 missense probably damaging 0.96
R1478:Xpo1 UTSW 11 23291623 missense probably damaging 0.99
R1483:Xpo1 UTSW 11 23284863 missense probably benign 0.04
R1694:Xpo1 UTSW 11 23281399 missense probably benign 0.12
R1775:Xpo1 UTSW 11 23271193 missense probably benign
R1827:Xpo1 UTSW 11 23285155 missense probably benign 0.00
R2262:Xpo1 UTSW 11 23284634 splice site probably null
R2263:Xpo1 UTSW 11 23284634 splice site probably null
R4510:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4511:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4840:Xpo1 UTSW 11 23278183 missense probably damaging 1.00
R4901:Xpo1 UTSW 11 23281327 missense possibly damaging 0.62
R5176:Xpo1 UTSW 11 23295977 missense probably damaging 0.99
R5508:Xpo1 UTSW 11 23294645 missense probably benign
R5927:Xpo1 UTSW 11 23268653 unclassified probably benign
R5927:Xpo1 UTSW 11 23268656 unclassified probably benign
R6110:Xpo1 UTSW 11 23287434 missense probably damaging 0.99
R6421:Xpo1 UTSW 11 23291490 missense possibly damaging 0.60
R6591:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6691:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6698:Xpo1 UTSW 11 23294040 missense probably benign 0.01
R6958:Xpo1 UTSW 11 23285855 missense probably benign
R7407:Xpo1 UTSW 11 23285823 missense probably damaging 1.00
R7482:Xpo1 UTSW 11 23282544 missense probably benign 0.00
R7624:Xpo1 UTSW 11 23282584 missense probably damaging 0.99
R8335:Xpo1 UTSW 11 23280603 splice site probably null
Z1176:Xpo1 UTSW 11 23296080 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- aagagggtgttgaatctcctg -3'
Posted On2013-07-11