Incidental Mutation 'R9006:Dhcr7'
ID 685298
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name 7-dehydrocholesterol reductase
Synonyms
MMRRC Submission 068836-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9006 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 143376882-143402147 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 143394978 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 165 (S165T)
Ref Sequence ENSEMBL: ENSMUSP00000146947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000125564] [ENSMUST00000128454] [ENSMUST00000141916] [ENSMUST00000143338] [ENSMUST00000207143] [ENSMUST00000144034] [ENSMUST00000145471]
AlphaFold O88455
Predicted Effect probably benign
Transcript: ENSMUST00000073878
AA Change: S162T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454
AA Change: S162T

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124340
AA Change: S162T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454
AA Change: S162T

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125564
Predicted Effect probably benign
Transcript: ENSMUST00000128454
Predicted Effect probably benign
Transcript: ENSMUST00000141916
AA Change: S162T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454
AA Change: S162T

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143338
AA Change: S162T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454
AA Change: S162T

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207143
AA Change: S165T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000144034
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Meta Mutation Damage Score 0.1695 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 45,665,820 (GRCm39) N267D probably benign Het
Akap1 A T 11: 88,723,996 (GRCm39) M803K possibly damaging Het
Amer2 G C 14: 60,617,376 (GRCm39) D524H probably damaging Het
Ankrd31 T C 13: 96,967,104 (GRCm39) F528L probably benign Het
Arhgef10l A G 4: 140,271,659 (GRCm39) Y624H probably benign Het
Bltp2 T C 11: 78,164,345 (GRCm39) F1182L possibly damaging Het
Cfap73 G A 5: 120,767,760 (GRCm39) Q264* probably null Het
Clca3a2 C A 3: 144,783,789 (GRCm39) A609S probably damaging Het
Cntfr A T 4: 41,661,971 (GRCm39) probably null Het
Cyp2c65 C T 19: 39,070,714 (GRCm39) T299I probably damaging Het
Cyp2j5 G T 4: 96,552,149 (GRCm39) N33K probably benign Het
Dnah10 A T 5: 124,820,783 (GRCm39) D539V probably benign Het
Ebag9 A T 15: 44,503,703 (GRCm39) Q176L probably benign Het
Fbxw20 T A 9: 109,062,530 (GRCm39) probably benign Het
Ftmt A G 18: 52,465,112 (GRCm39) K143E possibly damaging Het
Gcc2 C T 10: 58,103,801 (GRCm39) R76C probably damaging Het
Gcn1 A G 5: 115,719,566 (GRCm39) T354A probably benign Het
Gtf2h1 A G 7: 46,458,262 (GRCm39) M271V probably benign Het
Iah1 G A 12: 21,367,402 (GRCm39) G36D probably damaging Het
Ism2 G T 12: 87,326,969 (GRCm39) D323E probably damaging Het
Itih4 A G 14: 30,612,086 (GRCm39) I184V probably damaging Het
Kdm4d C A 9: 14,374,833 (GRCm39) V342L probably benign Het
Lmbr1 A G 5: 29,551,900 (GRCm39) F62L probably benign Het
Lmo7 TCGGATTCTGTGGC TC 14: 102,155,072 (GRCm39) probably benign Het
Lypd8 T A 11: 58,277,586 (GRCm39) S123T possibly damaging Het
Mical2 T A 7: 111,981,323 (GRCm39) N432K probably benign Het
Mrgprb4 A G 7: 47,848,343 (GRCm39) V195A probably benign Het
Ms4a4c A T 19: 11,396,360 (GRCm39) I106F probably benign Het
Myo6 A G 9: 80,136,140 (GRCm39) T88A unknown Het
Naa35 A G 13: 59,748,842 (GRCm39) D158G possibly damaging Het
Nol12 A G 15: 78,824,291 (GRCm39) E137G possibly damaging Het
Nsun4 A G 4: 115,897,316 (GRCm39) S232P probably damaging Het
Odad2 A T 18: 7,294,516 (GRCm39) N32K probably benign Het
Odam A T 5: 88,040,298 (GRCm39) I255L probably benign Het
Or14j8 A T 17: 38,263,545 (GRCm39) Y123* probably null Het
Or1ad8 A T 11: 50,897,975 (GRCm39) M59L probably damaging Het
Or1e26 T A 11: 73,480,036 (GRCm39) H176L probably benign Het
Or2n1d T C 17: 38,646,723 (GRCm39) V225A possibly damaging Het
Or2w3b G A 11: 58,623,188 (GRCm39) Q268* probably null Het
Or4b1 T G 2: 89,980,327 (GRCm39) T8P probably damaging Het
Pcnx2 T C 8: 126,613,996 (GRCm39) D485G probably benign Het
Polr3b T A 10: 84,467,697 (GRCm39) N92K probably benign Het
Rpgrip1l T A 8: 92,007,436 (GRCm39) M385L probably benign Het
Sdk1 A T 5: 141,923,321 (GRCm39) N314I probably damaging Het
Shc4 T C 2: 125,514,394 (GRCm39) probably benign Het
Slc45a1 A C 4: 150,722,731 (GRCm39) C384W probably damaging Het
Slc4a11 C T 2: 130,532,773 (GRCm39) V227M probably damaging Het
Sorbs2 A C 8: 46,258,858 (GRCm39) S1132R possibly damaging Het
Spata31e3 G A 13: 50,401,589 (GRCm39) H246Y possibly damaging Het
Spata31f1e C T 4: 42,792,546 (GRCm39) G529S probably benign Het
Spta1 T A 1: 174,047,537 (GRCm39) I1727K probably damaging Het
Srgap2 T C 1: 131,283,307 (GRCm39) E258G probably damaging Het
Taco1 A T 11: 105,956,931 (GRCm39) probably benign Het
Taf2 A T 15: 54,909,301 (GRCm39) M648K possibly damaging Het
Taf7 A G 18: 37,775,757 (GRCm39) V270A probably benign Het
Tbkbp1 G A 11: 97,029,707 (GRCm39) T483I unknown Het
Tesc A G 5: 118,184,378 (GRCm39) probably null Het
Tgs1 A G 4: 3,595,427 (GRCm39) N532S probably benign Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tmem196 T A 12: 119,978,510 (GRCm39) C84S probably damaging Het
Topbp1 C T 9: 103,182,499 (GRCm39) probably benign Het
Ttc16 A G 2: 32,652,985 (GRCm39) S615P probably benign Het
Ttc21a T A 9: 119,792,130 (GRCm39) probably benign Het
Tuba3b T C 6: 145,565,564 (GRCm39) V344A possibly damaging Het
Tubgcp4 T C 2: 121,015,251 (GRCm39) F320L probably benign Het
Tusc3 T A 8: 39,538,627 (GRCm39) L222* probably null Het
Ubr4 G A 4: 139,172,003 (GRCm39) probably null Het
Uncx G T 5: 139,532,936 (GRCm39) V334L possibly damaging Het
Vezf1 C A 11: 87,965,542 (GRCm39) F261L probably damaging Het
Vezt T A 10: 93,809,874 (GRCm39) I556L probably benign Het
Vmn1r172 C T 7: 23,359,402 (GRCm39) R96C probably benign Het
Zfp383 A G 7: 29,608,070 (GRCm39) M1V probably null Het
Zfp558 A T 9: 18,367,776 (GRCm39) S337R possibly damaging Het
Zranb1 T A 7: 132,572,909 (GRCm39) probably benign Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143,400,805 (GRCm39) missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143,395,056 (GRCm39) missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143,397,048 (GRCm39) missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143,399,236 (GRCm39) missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143,396,865 (GRCm39) missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143,401,103 (GRCm39) missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143,394,234 (GRCm39) missense possibly damaging 0.80
R0350:Dhcr7 UTSW 7 143,391,507 (GRCm39) missense probably damaging 1.00
R0433:Dhcr7 UTSW 7 143,394,200 (GRCm39) missense possibly damaging 0.92
R0834:Dhcr7 UTSW 7 143,394,964 (GRCm39) missense probably benign 0.19
R1473:Dhcr7 UTSW 7 143,400,805 (GRCm39) missense probably damaging 0.99
R1473:Dhcr7 UTSW 7 143,395,105 (GRCm39) missense probably damaging 1.00
R1769:Dhcr7 UTSW 7 143,401,250 (GRCm39) missense probably damaging 1.00
R1773:Dhcr7 UTSW 7 143,401,195 (GRCm39) missense possibly damaging 0.87
R1997:Dhcr7 UTSW 7 143,401,167 (GRCm39) missense probably damaging 0.99
R2302:Dhcr7 UTSW 7 143,391,629 (GRCm39) missense probably benign 0.00
R4177:Dhcr7 UTSW 7 143,394,910 (GRCm39) missense probably damaging 1.00
R4275:Dhcr7 UTSW 7 143,396,964 (GRCm39) missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143,391,654 (GRCm39) missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4944:Dhcr7 UTSW 7 143,391,528 (GRCm39) missense probably damaging 0.96
R5000:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.94
R5454:Dhcr7 UTSW 7 143,391,576 (GRCm39) missense probably damaging 1.00
R5633:Dhcr7 UTSW 7 143,401,160 (GRCm39) missense probably damaging 0.99
R6337:Dhcr7 UTSW 7 143,390,468 (GRCm39) critical splice donor site probably null
R6683:Dhcr7 UTSW 7 143,397,048 (GRCm39) missense probably damaging 0.99
R7175:Dhcr7 UTSW 7 143,399,227 (GRCm39) missense probably damaging 1.00
R7785:Dhcr7 UTSW 7 143,399,209 (GRCm39) missense probably damaging 1.00
R8947:Dhcr7 UTSW 7 143,400,959 (GRCm39) missense probably damaging 1.00
R9052:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.79
R9629:Dhcr7 UTSW 7 143,401,212 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACCCCTGTCCTTCAGAATG -3'
(R):5'- GTACCATCCATTCCAGGCTTGC -3'

Sequencing Primer
(F):5'- TCCTTCAGAATGGTACCTGGAAGC -3'
(R):5'- GCTTGCCCAGATGCTAAGGAAC -3'
Posted On 2021-10-11