Incidental Mutation 'R1473:Dhcr7'
ID165928
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name7-dehydrocholesterol reductase
Synonyms
MMRRC Submission 039526-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1473 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143823145-143848410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143847068 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 323 (Y323H)
Ref Sequence ENSEMBL: ENSMUSP00000121782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000141916] [ENSMUST00000143338] [ENSMUST00000144034] [ENSMUST00000145471] [ENSMUST00000207143]
Predicted Effect probably damaging
Transcript: ENSMUST00000073878
AA Change: Y323H

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454
AA Change: Y323H

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124340
AA Change: Y323H

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454
AA Change: Y323H

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128610
Predicted Effect probably damaging
Transcript: ENSMUST00000141916
AA Change: Y323H

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454
AA Change: Y323H

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143338
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144034
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Predicted Effect probably damaging
Transcript: ENSMUST00000207143
AA Change: Y326H

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.1692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,068,236 D342G probably damaging Het
Acad8 T C 9: 26,979,041 T293A probably benign Het
Adamts13 C A 2: 26,981,753 Y310* probably null Het
Adcy6 T A 15: 98,592,743 Y1102F probably damaging Het
Ahctf1 G A 1: 179,776,108 T791M probably benign Het
Ahctf1 A G 1: 179,799,279 V18A probably damaging Het
Ampd3 T G 7: 110,804,935 S564R probably damaging Het
Anapc1 A T 2: 128,617,697 I1814K possibly damaging Het
Arl4c A T 1: 88,701,609 L19Q probably damaging Het
Atp6v0e2 T C 6: 48,539,264 Y49H probably damaging Het
Ccdc24 G T 4: 117,869,904 probably benign Het
Clcn6 A C 4: 148,024,156 F139V possibly damaging Het
Col2a1 A G 15: 97,982,908 probably benign Het
Crip2 T A 12: 113,143,500 C29S probably damaging Het
Cyp2a4 A C 7: 26,314,763 N455T probably benign Het
Dnah7a A C 1: 53,496,014 S2696A probably benign Het
Dnajc12 A G 10: 63,397,244 T55A probably benign Het
Drosha G A 15: 12,912,520 E1075K probably benign Het
Duox2 A G 2: 122,287,121 S911P possibly damaging Het
Ephb2 G A 4: 136,694,058 A327V possibly damaging Het
Espl1 C T 15: 102,320,443 T1711I possibly damaging Het
Fmnl2 A G 2: 52,858,207 K22R possibly damaging Het
Fzd6 T C 15: 39,030,963 F175L probably damaging Het
Gm4737 T A 16: 46,154,819 E65V probably damaging Het
Gm5155 A G 7: 17,905,091 noncoding transcript Het
Gm6526 A G 14: 43,748,846 I76M probably damaging Het
Gm6583 T C 5: 112,354,549 T430A probably benign Het
Gm9881 A T 16: 91,170,735 F34I unknown Het
Gm9892 T C 8: 52,196,614 D148G possibly damaging Het
Grb10 C T 11: 11,934,249 V486I probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdac4 T C 1: 92,029,968 H108R possibly damaging Het
Hist2h2bb G T 3: 96,270,072 L107F probably damaging Het
Hmcn1 G A 1: 150,772,552 T661I probably benign Het
Icam1 T A 9: 21,027,876 I515N probably damaging Het
Ifi208 A G 1: 173,695,654 R497G possibly damaging Het
Igsf10 A T 3: 59,318,767 V2495E probably damaging Het
Iqgap1 T C 7: 80,734,011 M1102V probably benign Het
Itgb4 A T 11: 115,984,047 N410I probably benign Het
Jup T C 11: 100,379,601 H360R possibly damaging Het
Kif20b T A 19: 34,974,496 S1685T possibly damaging Het
Lins1 T C 7: 66,712,046 probably null Het
Lrig1 T A 6: 94,607,313 T917S probably benign Het
Mast2 A G 4: 116,311,955 S814P probably damaging Het
Mast4 T C 13: 102,772,519 T483A probably damaging Het
Mcpt1 T C 14: 56,019,533 M176T probably benign Het
Mettl22 A G 16: 8,473,961 Q38R probably damaging Het
Mrm2 T C 5: 140,328,688 T131A probably benign Het
Nde1 T G 16: 14,185,864 F71V probably benign Het
Nxn C T 11: 76,263,187 G274D possibly damaging Het
Olfr1230 A T 2: 89,296,906 Y121* probably null Het
Olfr183 A T 16: 58,999,912 T76S probably benign Het
Olfr414 T A 1: 174,430,643 W72R probably damaging Het
Olfr427 G T 1: 174,099,749 C97F probably damaging Het
Osbp2 T C 11: 3,717,175 probably null Het
Otud7a C A 7: 63,754,629 probably benign Het
Phf3 G A 1: 30,805,940 L1313F probably damaging Het
Pkhd1 A T 1: 20,522,983 D1635E probably benign Het
Plpp1 A G 13: 112,859,664 H171R probably damaging Het
Pofut1 A G 2: 153,261,246 M172V probably damaging Het
Prmt5 A G 14: 54,508,915 F580L probably damaging Het
Rab11fip3 A T 17: 25,991,322 L987Q probably damaging Het
Retnlb T A 16: 48,818,665 C76* probably null Het
Rnf38 T C 4: 44,131,584 N399S probably benign Het
Sbk1 A G 7: 126,292,252 E286G possibly damaging Het
Scin T A 12: 40,077,502 T430S probably benign Het
Sgsm1 T A 5: 113,263,257 T868S probably benign Het
Sipa1l1 G A 12: 82,341,111 R37H probably damaging Het
Smchd1 A T 17: 71,361,837 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Soga1 A T 2: 157,020,448 Y1520* probably null Het
Stk32c C T 7: 139,125,179 R23Q probably damaging Het
Sult1d1 A G 5: 87,564,739 M82T probably benign Het
Tat T C 8: 109,996,918 L346P probably damaging Het
Tenm3 C A 8: 48,310,625 G789V probably damaging Het
Thsd7a C T 6: 12,338,622 S1203N probably benign Het
Tmem191c G A 16: 17,277,962 probably null Het
Tmem268 A G 4: 63,580,338 T239A probably damaging Het
Tmem82 A C 4: 141,616,278 L227R possibly damaging Het
Ttn A T 2: 76,727,032 I29906N probably damaging Het
Txndc15 T C 13: 55,721,574 probably benign Het
Ubqln4 A G 3: 88,565,845 I536V probably benign Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r102 A T 17: 19,694,581 I803F probably benign Het
Vmn2r6 G T 3: 64,538,158 Y715* probably null Het
Vmn2r74 A T 7: 85,961,410 C25S probably damaging Het
Wdr38 A G 2: 39,000,979 T261A probably benign Het
Zfp653 T C 9: 22,058,220 E250G possibly damaging Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143847068 missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143841319 missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143843311 missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143845499 missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143843128 missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143847366 missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143840497 missense possibly damaging 0.80
R0350:Dhcr7 UTSW 7 143837770 missense probably damaging 1.00
R0433:Dhcr7 UTSW 7 143840463 missense possibly damaging 0.92
R0834:Dhcr7 UTSW 7 143841227 missense probably benign 0.19
R1473:Dhcr7 UTSW 7 143841368 missense probably damaging 1.00
R1769:Dhcr7 UTSW 7 143847513 missense probably damaging 1.00
R1773:Dhcr7 UTSW 7 143847458 missense possibly damaging 0.87
R1997:Dhcr7 UTSW 7 143847430 missense probably damaging 0.99
R2302:Dhcr7 UTSW 7 143837892 missense probably benign 0.00
R4177:Dhcr7 UTSW 7 143841173 missense probably damaging 1.00
R4275:Dhcr7 UTSW 7 143843227 missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143837917 missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143840500 missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143840500 missense probably benign 0.05
R4944:Dhcr7 UTSW 7 143837791 missense probably damaging 0.96
R5000:Dhcr7 UTSW 7 143841323 missense possibly damaging 0.94
R5454:Dhcr7 UTSW 7 143837839 missense probably damaging 1.00
R5633:Dhcr7 UTSW 7 143847423 missense probably damaging 0.99
R6337:Dhcr7 UTSW 7 143836731 critical splice donor site probably null
R6683:Dhcr7 UTSW 7 143843311 missense probably damaging 0.99
R7175:Dhcr7 UTSW 7 143845490 missense probably damaging 1.00
R7785:Dhcr7 UTSW 7 143845472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGATGTGTGCCTTCCTGC -3'
(R):5'- AAGCCTGAGACCAACAGCTTGC -3'

Sequencing Primer
(F):5'- GCCCCCCTTGTATCTTACTTAACAG -3'
(R):5'- TGGTGCTTCAGCCCATCAG -3'
Posted On2014-03-28