Incidental Mutation 'R5454:Dhcr7'
ID432671
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name7-dehydrocholesterol reductase
Synonyms
MMRRC Submission 043018-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5454 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143823145-143848410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 143837839 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 55 (M55R)
Ref Sequence ENSEMBL: ENSMUSP00000146636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000125564] [ENSMUST00000128454] [ENSMUST00000141916] [ENSMUST00000143338] [ENSMUST00000144034] [ENSMUST00000145471] [ENSMUST00000207143]
Predicted Effect probably damaging
Transcript: ENSMUST00000073878
AA Change: M55R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454
AA Change: M55R

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124340
AA Change: M55R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454
AA Change: M55R

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125564
AA Change: M55R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000128454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128610
Predicted Effect probably damaging
Transcript: ENSMUST00000141916
AA Change: M55R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454
AA Change: M55R

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143338
AA Change: M55R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454
AA Change: M55R

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000144034
AA Change: M55R
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454
AA Change: M55R

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Predicted Effect probably damaging
Transcript: ENSMUST00000207143
AA Change: M58R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208631
Meta Mutation Damage Score 0.7518 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,168,988 noncoding transcript Het
Ankfy1 A T 11: 72,746,931 H483L probably benign Het
Ankrd46 C T 15: 36,479,301 G215R probably damaging Het
Apobec1 T C 6: 122,581,368 I143V probably benign Het
Atp2b4 C A 1: 133,729,872 V627F probably damaging Het
Ccdc80 T A 16: 45,127,225 Y855* probably null Het
Cd209b T C 8: 3,925,396 E88G probably damaging Het
Ceacam14 T G 7: 17,814,185 W67G probably damaging Het
Cope T C 8: 70,304,656 V50A probably benign Het
Dcaf13 C A 15: 39,124,364 D168E probably benign Het
Enpp7 A T 11: 118,988,808 Y96F probably benign Het
Esco1 T C 18: 10,584,327 D60G probably benign Het
Fgfr3 G A 5: 33,723,298 probably benign Het
Frzb T C 2: 80,417,915 D280G probably damaging Het
Gcat A G 15: 79,036,410 I317V probably benign Het
Gm13030 A T 4: 138,873,509 probably benign Het
Gmds A G 13: 32,128,041 L135P probably damaging Het
Htra2 G A 6: 83,054,014 P138L probably damaging Het
Il5 A G 11: 53,723,799 N89S probably damaging Het
Ints3 G A 3: 90,408,527 T310M possibly damaging Het
Itih2 T C 2: 10,097,993 I777V probably null Het
Kctd9 T C 14: 67,740,387 L382S probably damaging Het
Lor A G 3: 92,081,482 S166P unknown Het
Mga T A 2: 119,903,329 N219K probably damaging Het
Mtmr4 A T 11: 87,611,042 R641* probably null Het
Muc6 C T 7: 141,648,813 A611T possibly damaging Het
Obox3-ps8 A T 17: 36,453,011 noncoding transcript Het
Olfr474 A T 7: 107,954,889 M83L probably benign Het
Otud4 C T 8: 79,651,042 L111F possibly damaging Het
Pcdhga12 T A 18: 37,766,261 S49T possibly damaging Het
Pcdhgc3 A G 18: 37,808,496 D650G probably damaging Het
Pcmt1 A G 10: 7,640,745 V167A probably damaging Het
Pcnt A T 10: 76,389,547 probably null Het
Pcx G T 19: 4,602,476 V164F probably damaging Het
Plekhg4 T C 8: 105,376,113 probably null Het
Pmch A G 10: 88,091,845 E136G probably damaging Het
Prkar1a A G 11: 109,660,060 D80G probably benign Het
Ryr3 T C 2: 112,730,302 probably null Het
Slc10a7 T C 8: 78,686,624 S171P possibly damaging Het
Sox6 A T 7: 115,701,773 M153K possibly damaging Het
Srgap2 T C 1: 131,289,737 I946V probably benign Het
Strbp T C 2: 37,645,483 E71G probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tnrc18 T C 5: 142,771,691 D1025G unknown Het
Tnxb A G 17: 34,709,625 H2671R possibly damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Umodl1 A T 17: 30,986,465 D649V possibly damaging Het
Usp13 G T 3: 32,905,436 A559S probably damaging Het
Vps45 G A 3: 96,019,657 P526L probably benign Het
Zfp687 A G 3: 95,009,146 V855A probably damaging Het
Zfp771 T A 7: 127,254,276 C205S probably damaging Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143847068 missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143841319 missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143843311 missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143845499 missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143843128 missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143847366 missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143840497 missense possibly damaging 0.80
R0350:Dhcr7 UTSW 7 143837770 missense probably damaging 1.00
R0433:Dhcr7 UTSW 7 143840463 missense possibly damaging 0.92
R0834:Dhcr7 UTSW 7 143841227 missense probably benign 0.19
R1473:Dhcr7 UTSW 7 143841368 missense probably damaging 1.00
R1473:Dhcr7 UTSW 7 143847068 missense probably damaging 0.99
R1769:Dhcr7 UTSW 7 143847513 missense probably damaging 1.00
R1773:Dhcr7 UTSW 7 143847458 missense possibly damaging 0.87
R1997:Dhcr7 UTSW 7 143847430 missense probably damaging 0.99
R2302:Dhcr7 UTSW 7 143837892 missense probably benign 0.00
R4177:Dhcr7 UTSW 7 143841173 missense probably damaging 1.00
R4275:Dhcr7 UTSW 7 143843227 missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143837917 missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143840500 missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143840500 missense probably benign 0.05
R4944:Dhcr7 UTSW 7 143837791 missense probably damaging 0.96
R5000:Dhcr7 UTSW 7 143841323 missense possibly damaging 0.94
R5633:Dhcr7 UTSW 7 143847423 missense probably damaging 0.99
R6337:Dhcr7 UTSW 7 143836731 critical splice donor site probably null
R6683:Dhcr7 UTSW 7 143843311 missense probably damaging 0.99
R7175:Dhcr7 UTSW 7 143845490 missense probably damaging 1.00
R7785:Dhcr7 UTSW 7 143845472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGTCCAAGGAACAGAAGAG -3'
(R):5'- CTGCACCCTGACTTGAACATC -3'

Sequencing Primer
(F):5'- CAGAAGAGGGTCTCTAAGTCCC -3'
(R):5'- GACTTGAACATCACTCTGGGTCAG -3'
Posted On2016-10-06