Incidental Mutation 'R1769:Dhcr7'
ID194697
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name7-dehydrocholesterol reductase
Synonyms
MMRRC Submission 039800-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1769 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143823145-143848410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143847513 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 474 (F474S)
Ref Sequence ENSEMBL: ENSMUSP00000146947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000141916] [ENSMUST00000143338] [ENSMUST00000144034] [ENSMUST00000145471] [ENSMUST00000207143]
Predicted Effect probably damaging
Transcript: ENSMUST00000073878
AA Change: F471S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454
AA Change: F471S

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124340
AA Change: F471S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454
AA Change: F471S

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128610
Predicted Effect probably damaging
Transcript: ENSMUST00000141916
AA Change: F471S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454
AA Change: F471S

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143338
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144034
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Predicted Effect probably damaging
Transcript: ENSMUST00000207143
AA Change: F474S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.9474 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,591,821 probably benign Het
A430033K04Rik A G 5: 138,646,257 I135V probably benign Het
Abca1 T A 4: 53,074,325 K1119N probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcc9 T C 6: 142,627,468 probably benign Het
Akap3 A G 6: 126,865,846 E476G possibly damaging Het
Aldh3b1 A G 19: 3,918,740 F271S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ascc3 T C 10: 50,700,490 V847A probably damaging Het
Best3 A G 10: 117,023,978 N381S probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Bmpr2 T A 1: 59,868,361 L871Q probably damaging Het
Car13 T A 3: 14,650,735 H104Q probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ccnb1ip1 T C 14: 50,792,111 M165V probably benign Het
Cd4 A T 6: 124,866,655 M431K possibly damaging Het
Cdh7 C T 1: 110,052,876 T178I probably damaging Het
Ceacam3 C T 7: 17,158,376 T348I probably damaging Het
Cfap54 C T 10: 92,904,263 probably null Het
Clcn6 A T 4: 148,014,301 probably null Het
Csf3 A G 11: 98,702,420 Y121C probably damaging Het
Csmd3 C T 15: 47,704,109 probably benign Het
Cyp2c69 A G 19: 39,876,371 I221T probably benign Het
Dgcr2 T C 16: 17,857,251 probably benign Het
Dnah1 T C 14: 31,310,882 I399V probably null Het
Efcab14 T A 4: 115,752,991 L183Q probably damaging Het
Elmsan1 G A 12: 84,158,350 probably benign Het
Evx2 A G 2: 74,659,157 V88A probably benign Het
Exph5 A G 9: 53,373,809 N730S probably benign Het
Farsb T A 1: 78,466,983 K196I probably benign Het
Fbln7 C T 2: 128,893,762 probably benign Het
Fhdc1 A G 3: 84,448,778 F453S probably damaging Het
Gast T A 11: 100,336,858 W89R probably damaging Het
Gata2 A G 6: 88,205,255 S402G probably benign Het
Gin1 T A 1: 97,792,437 S386T probably benign Het
Golgb1 A G 16: 36,916,001 E1870G probably damaging Het
Hivep3 T A 4: 120,097,571 V1028E possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Ifi209 G A 1: 173,641,162 S186N probably benign Het
Ifih1 C T 2: 62,606,394 A562T probably damaging Het
Itch T C 2: 155,172,561 L106S probably damaging Het
Itga4 T A 2: 79,315,706 probably null Het
Kdm4c A G 4: 74,280,997 S141G possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra3 T C 6: 130,330,263 probably null Het
Lama2 A T 10: 27,208,406 S923T probably damaging Het
Lama2 G C 10: 27,208,407 F922L probably benign Het
Llgl1 G A 11: 60,707,047 V331M probably damaging Het
Lrrc30 T C 17: 67,631,681 *301W probably null Het
Map1lc3b C T 8: 121,593,487 probably benign Het
Mbd2 A G 18: 70,616,619 I302V probably benign Het
Med27 A G 2: 29,500,295 Y78C probably damaging Het
Mei1 C T 15: 82,112,570 probably null Het
Miga1 T C 3: 152,287,554 E346G probably damaging Het
Myef2 A G 2: 125,115,443 S131P probably damaging Het
Myocd T C 11: 65,178,701 H899R probably benign Het
Ncam1 A G 9: 49,545,256 probably benign Het
Ngf T A 3: 102,520,197 N87K possibly damaging Het
Nol10 T A 12: 17,416,708 probably benign Het
Nrip2 A G 6: 128,408,268 I221V probably benign Het
Nup205 G A 6: 35,205,431 G777D probably damaging Het
Olfr1446 A G 19: 12,889,683 V298A probably damaging Het
Olfr199 A G 16: 59,215,981 F211L probably benign Het
Olfr802 T A 10: 129,682,212 T176S probably benign Het
Olfr855 A T 9: 19,585,386 Q283L probably damaging Het
Olfr974 G T 9: 39,942,955 D232Y probably benign Het
Oxt A T 2: 130,576,300 R31W probably damaging Het
Pde4dip A G 3: 97,695,930 S2248P probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pkp2 T C 16: 16,262,697 S616P probably damaging Het
Plch2 T C 4: 155,000,083 Y379C probably damaging Het
Pnpt1 A G 11: 29,154,159 N540D probably benign Het
Ptpn23 G A 9: 110,391,678 H255Y possibly damaging Het
Rad21 T C 15: 51,972,307 N237D probably benign Het
Ryr3 A C 2: 112,751,768 probably null Het
Sgk1 C A 10: 21,997,108 probably benign Het
Slc1a5 G T 7: 16,797,539 A490S probably damaging Het
Slc5a8 T C 10: 88,919,464 Y478H probably benign Het
Slc5a8 T A 10: 88,919,466 Y478* probably null Het
Slc9a3 A T 13: 74,163,071 M562L probably benign Het
Thsd7a G A 6: 12,555,715 R57* probably null Het
Tiam1 T C 16: 89,860,279 R690G probably damaging Het
Tmem150b A G 7: 4,724,366 S47P probably damaging Het
Trim39 C T 17: 36,263,940 R190Q probably damaging Het
Ttc32 A T 12: 9,035,073 I98L possibly damaging Het
Vps13c A G 9: 67,965,721 T3304A probably benign Het
Wdr35 A C 12: 9,012,728 D638A probably damaging Het
Wwc1 G T 11: 35,861,844 P797T probably benign Het
Zan T A 5: 137,464,518 T800S unknown Het
Zbbx A G 3: 75,083,619 probably benign Het
Zufsp T C 10: 33,935,176 M291V probably damaging Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143847068 missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143841319 missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143843311 missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143845499 missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143843128 missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143847366 missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143840497 missense possibly damaging 0.80
R0350:Dhcr7 UTSW 7 143837770 missense probably damaging 1.00
R0433:Dhcr7 UTSW 7 143840463 missense possibly damaging 0.92
R0834:Dhcr7 UTSW 7 143841227 missense probably benign 0.19
R1473:Dhcr7 UTSW 7 143841368 missense probably damaging 1.00
R1473:Dhcr7 UTSW 7 143847068 missense probably damaging 0.99
R1773:Dhcr7 UTSW 7 143847458 missense possibly damaging 0.87
R1997:Dhcr7 UTSW 7 143847430 missense probably damaging 0.99
R2302:Dhcr7 UTSW 7 143837892 missense probably benign 0.00
R4177:Dhcr7 UTSW 7 143841173 missense probably damaging 1.00
R4275:Dhcr7 UTSW 7 143843227 missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143837917 missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143840500 missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143840500 missense probably benign 0.05
R4944:Dhcr7 UTSW 7 143837791 missense probably damaging 0.96
R5000:Dhcr7 UTSW 7 143841323 missense possibly damaging 0.94
R5454:Dhcr7 UTSW 7 143837839 missense probably damaging 1.00
R5633:Dhcr7 UTSW 7 143847423 missense probably damaging 0.99
R6337:Dhcr7 UTSW 7 143836731 critical splice donor site probably null
R6683:Dhcr7 UTSW 7 143843311 missense probably damaging 0.99
R7175:Dhcr7 UTSW 7 143845490 missense probably damaging 1.00
R7785:Dhcr7 UTSW 7 143845472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGCCACTTCAACTATACTGGTGAC -3'
(R):5'- GCCTCTGCTATCAGGATGCTGAAC -3'

Sequencing Primer
(F):5'- CAACTATACTGGTGACCTGATGG -3'
(R):5'- AACAAGCCATTCTGCTGGG -3'
Posted On2014-05-23