Incidental Mutation 'R9088:Mlkl'
ID 690763
Institutional Source Beutler Lab
Gene Symbol Mlkl
Ensembl Gene ENSMUSG00000012519
Gene Name mixed lineage kinase domain-like
Synonyms 9130019I15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R9088 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 111311797-111338177 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 111322733 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 253 (R253S)
Ref Sequence ENSEMBL: ENSMUSP00000055521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056157] [ENSMUST00000120432]
AlphaFold Q9D2Y4
PDB Structure Structure of MLKL [X-RAY DIFFRACTION]
Crystal structure of the mouse MLKL kinase-like domain [X-RAY DIFFRACTION]
Crystal structure of the mouse RIP3-MLKL complex [X-RAY DIFFRACTION]
Predicted Effect
SMART Domains Protein: ENSMUSP00000055521
Gene: ENSMUSG00000012519
AA Change: R253S

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 448 2.7e-41 PFAM
Pfam:Pkinase 200 450 2.1e-30 PFAM
Pfam:Kinase-like 270 438 1.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120432
AA Change: R253S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113718
Gene: ENSMUSG00000012519
AA Change: R253S

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 453 3.3e-42 PFAM
Pfam:Pkinase 196 453 1.4e-33 PFAM
Pfam:Kinase-like 270 438 8.9e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the protein kinase superfamily. The encoded protein contains a protein kinase-like domain; however, is thought to lack protein kinase activity. This protein plays a critical role in tumor necrosis factor (TNF)-induced necroptosis, a programmed cell death process, via interaction with receptor-interacting protein 3 (Rip3), which is a key signaling molecule in necroptosis pathway. Knockout of this gene in mice showed that it is essential for necroptosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired macrophage and mouse embryonic fibroblast necroptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,406,874 Y1212C Het
Asah2 T C 19: 32,052,960 Q104R probably damaging Het
Bnipl T A 3: 95,250,984 R9* probably null Het
Bpifa3 A C 2: 154,133,765 N85T possibly damaging Het
C6 T C 15: 4,763,474 Y354H probably damaging Het
Caln1 A T 5: 130,414,776 probably benign Het
Capn3 T C 2: 120,490,970 F378L probably benign Het
Car6 T C 4: 150,197,349 H125R probably damaging Het
Ccdc110 G A 8: 45,941,845 E258K probably damaging Het
Cep295 C A 9: 15,322,519 R2327L probably benign Het
Col14a1 T A 15: 55,363,527 D224E unknown Het
Col16a1 T A 4: 130,077,223 S938T unknown Het
Col4a2 A G 8: 11,443,227 E1340G possibly damaging Het
Col6a6 C T 9: 105,784,077 V278M probably damaging Het
Crybg2 T A 4: 134,072,579 L41Q probably damaging Het
Ctss A T 3: 95,529,556 D50V possibly damaging Het
Ddx56 C T 11: 6,259,612 A500T probably benign Het
Dmbt1 T C 7: 131,116,689 V1713A unknown Het
Dnah1 T C 14: 31,266,013 I3483V probably benign Het
E130308A19Rik T A 4: 59,737,594 F402I probably benign Het
Eml6 A T 11: 29,818,424 H754Q probably damaging Het
Ern2 A G 7: 122,173,667 Y576H probably damaging Het
Fat4 T C 3: 39,007,299 S4344P probably benign Het
Fbxo40 A G 16: 36,969,788 I320T Het
Fbxw22 C T 9: 109,378,884 D440N probably damaging Het
Fgd2 A G 17: 29,364,939 E109G probably damaging Het
Gm17359 G A 3: 79,430,122 G185D probably damaging Het
Gm19410 A T 8: 35,773,612 D214V probably damaging Het
Gm884 T C 11: 103,620,936 K69E unknown Het
Hivep2 T C 10: 14,131,251 Y1198H probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Lrrc8e G A 8: 4,234,410 V212M probably damaging Het
Map2 A T 1: 66,414,614 S888C probably damaging Het
Met G T 6: 17,548,716 G920* probably null Het
Mmachc T A 4: 116,704,632 I102F probably damaging Het
Mnt G T 11: 74,843,054 V504L unknown Het
Mup14 C T 4: 61,302,497 G96D probably damaging Het
Myh13 G A 11: 67,352,059 E933K probably damaging Het
Ncoa6 A G 2: 155,407,806 S1193P probably damaging Het
Nek10 T C 14: 14,931,314 I762T probably damaging Het
Nmur1 G T 1: 86,387,530 F204L probably benign Het
Olfr151 T A 9: 37,730,510 I158F probably damaging Het
Olfr356 A G 2: 36,937,976 N286D probably damaging Het
Olfr672 G T 7: 104,996,094 P270Q probably damaging Het
Pappa2 T C 1: 158,936,357 Y528C probably damaging Het
Patl1 T C 19: 11,942,925 S748P possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Polr1a A G 6: 71,931,783 T531A probably benign Het
Slit3 C T 11: 35,121,636 S41F possibly damaging Het
Snap29 A G 16: 17,428,194 Q226R probably damaging Het
Tmpo A G 10: 91,153,276 probably null Het
Tnfrsf21 G A 17: 43,037,716 G73E probably damaging Het
Tsc1 T A 2: 28,662,605 C119S possibly damaging Het
Uox A G 3: 146,624,614 Y199C probably damaging Het
Vav2 T C 2: 27,297,696 D231G possibly damaging Het
Vmn2r80 A T 10: 79,169,544 K338N probably benign Het
Xylt2 G A 11: 94,670,403 T178I probably benign Het
Zfp931 G T 2: 178,067,801 T264K probably damaging Het
Zgrf1 A G 3: 127,583,677 D857G probably benign Het
Other mutations in Mlkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mlkl APN 8 111319428 nonsense probably null
IGL01376:Mlkl APN 8 111319747 missense probably damaging 1.00
IGL02801:Mlkl APN 8 111316432 missense probably benign 0.18
IGL02965:Mlkl APN 8 111331837 missense probably benign 0.31
IGL03121:Mlkl APN 8 111314980 missense probably damaging 1.00
Ghoulish UTSW 8 111322748 missense probably damaging 1.00
mecro UTSW 8 111319716 critical splice donor site probably null
necro UTSW 8 111312100 intron probably benign
secro UTSW 8 111315567 intron probably benign
R0133:Mlkl UTSW 8 111327948 missense probably damaging 1.00
R0230:Mlkl UTSW 8 111315062 missense probably benign 0.07
R0387:Mlkl UTSW 8 111333350 missense probably damaging 1.00
R0497:Mlkl UTSW 8 111327873 missense probably damaging 1.00
R0735:Mlkl UTSW 8 111327801 unclassified probably benign
R1733:Mlkl UTSW 8 111322748 missense probably damaging 1.00
R1761:Mlkl UTSW 8 111333723 missense possibly damaging 0.81
R1911:Mlkl UTSW 8 111312100 intron probably benign
R2057:Mlkl UTSW 8 111333610 missense probably benign 0.07
R2921:Mlkl UTSW 8 111316447 missense probably benign 0.02
R3745:Mlkl UTSW 8 111315567 intron probably benign
R4760:Mlkl UTSW 8 111319716 critical splice donor site probably null
R5377:Mlkl UTSW 8 111327937 missense probably benign 0.23
R7052:Mlkl UTSW 8 111319442 missense possibly damaging 0.65
R7155:Mlkl UTSW 8 111319403 missense probably damaging 1.00
R7459:Mlkl UTSW 8 111333530 missense probably benign 0.36
R7728:Mlkl UTSW 8 111333619 missense probably damaging 1.00
R8036:Mlkl UTSW 8 111333454 missense probably damaging 1.00
R8064:Mlkl UTSW 8 111312068 missense probably benign 0.38
R9152:Mlkl UTSW 8 111319771 missense probably damaging 1.00
R9275:Mlkl UTSW 8 111316423 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AAGCACAGCTCTCTAACCTCTTAAG -3'
(R):5'- TACAGCCAAGCCTGTCACTC -3'

Sequencing Primer
(F):5'- TTAAGCTCTCACCTGCAGATC -3'
(R):5'- CCTATACCAAGAGTCGCTGATGGTG -3'
Posted On 2021-12-30