Mutagenetix > Incidental Mutation

Incidental Mutation 'R9179:Rasef'

696878

Institutional Source

Beutler Lab

Gene Symbol

Rasef

Ensembl Gene

ENSMUSG00000043003

Gene Name

RAS and EF hand domain containing

Synonyms

RAB45

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R9179 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73714579-73790994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 73744119 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 198 (T198I)

Ref Sequence

ENSEMBL: ENSMUSP00000099901 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]

AlphaFold

Q5RI75

Predicted Effect

probably damaging
Transcript: ENSMUST00000058292
AA Change: T270I

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: T270I

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
coiled coil region	55	251	N/A	INTRINSIC
RAB	429	598	4.94e-69	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102837
AA Change: T198I

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003
AA Change: T198I

Domain	Start	End	E-Value	Type
coiled coil region	5	179	N/A	INTRINSIC
RAB	357	526	4.94e-69	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000222414
AA Change: T351I

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	T	A	6: 124,356,923	M33L	probably benign	Het
2310003L06Rik	A	G	5: 87,972,031	T216A	probably benign	Het
5430403G16Rik	A	G	5: 109,675,842	C581R	probably damaging	Het
9330161L09Rik	A	C	12: 103,407,578	C12G	unknown	Het
Ahdc1	T	A	4: 133,061,618	F57I	possibly damaging	Het
Amotl1	C	A	9: 14,550,491	A809S	possibly damaging	Het
Ankfn1	C	T	11: 89,523,185	M121I	probably benign	Het
Aspm	A	G	1: 139,476,715	D1261G	probably damaging	Het
Axl	T	C	7: 25,770,233	T502A	probably damaging	Het
Catsperd	G	A	17: 56,661,252	D546N	probably benign	Het
Ccdc102a	A	G	8: 94,913,120	V182A	possibly damaging	Het
Cdh23	C	T	10: 60,317,885	A2309T	probably benign	Het
Cfap69	A	T	5: 5,626,064	N210K	probably benign	Het
Cnot1	A	G	8: 95,773,426	S147P	probably benign	Het
Cntnap5c	T	C	17: 58,293,917	S752P	probably benign	Het
Cyp3a41a	A	T	5: 145,705,844	M235K	probably benign	Het
Cyp4f15	A	G	17: 32,700,211	D336G	possibly damaging	Het
Dagla	A	G	19: 10,251,161	I631T	possibly damaging	Het
Dph6	C	T	2: 114,523,110	C199Y	probably damaging	Het
Ermard	T	A	17: 15,053,233	L360Q	probably damaging	Het
F830045P16Rik	T	C	2: 129,472,788	T190A	probably benign	Het
Fgfr3	G	T	5: 33,729,972	V212L	possibly damaging	Het
Flnb	C	A	14: 7,887,541	C450*	probably null	Het
Gls	T	C	1: 52,199,856	Y362C	probably damaging	Het
Gngt1	A	G	6: 3,994,246	D8G	possibly damaging	Het
Gns	T	C	10: 121,380,175	F276L		Het
Grin2d	A	G	7: 45,856,752	S572P	probably damaging	Het
Impa2	C	T	18: 67,289,403		probably benign	Het
Itgal	A	T	7: 127,306,711	D355V	probably benign	Het
Kdm6b	A	T	11: 69,406,695		probably null	Het
Klk1b1	T	A	7: 43,969,291	C31S	probably damaging	Het
Ldb3	A	T	14: 34,555,355	V354E	probably benign	Het
Mettl21c	T	A	1: 44,009,982	Y135F	probably benign	Het
Mocs1	A	G	17: 49,433,275	T77A	probably damaging	Het
Ndufs1	T	C	1: 63,170,115	N30D	probably benign	Het
Olfr1243	T	A	2: 89,528,150	K87*	probably null	Het
Olfr339	T	C	2: 36,422,114	S239P	probably damaging	Het
Otog	C	A	7: 46,288,461	P1865T	possibly damaging	Het
Pabpc1l	T	C	2: 164,031,220	S137P	probably damaging	Het
Pilrb1	C	A	5: 137,857,395	W78L	probably damaging	Het
Plekha6	A	G	1: 133,286,347	Y832C	possibly damaging	Het
Ppan	C	A	9: 20,891,903	Q424K	probably benign	Het
Ppp1r12a	T	A	10: 108,251,921	N544K	probably damaging	Het
Pramef25	T	C	4: 143,949,724	E270G	probably benign	Het
Pstpip2	A	G	18: 77,873,455	D246G	possibly damaging	Het
Rbm12	T	C	2: 156,096,543	H603R	probably benign	Het
Rims1	T	C	1: 22,412,266	R179G	probably damaging	Het
Scel	T	C	14: 103,574,400	L288P	possibly damaging	Het
Sel1l	A	T	12: 91,811,952	D696E	probably benign	Het
Slc4a8	A	G	15: 100,791,601	K416R	possibly damaging	Het
Tmem132b	A	T	5: 125,623,051	M218L	probably benign	Het
Tnrc6a	T	C	7: 123,192,658	S1800P	probably benign	Het
Tpcn1	A	C	5: 120,541,950	L576R	probably damaging	Het
Vmn2r34	T	G	7: 7,672,724	Q555P	possibly damaging	Het
Vwa8	C	T	14: 79,098,361	T1419I	probably benign	Het
Xrn2	T	C	2: 147,013,161	Y14H	probably benign	Het
Zfyve28	A	T	5: 34,225,032	D241E	probably benign	Het

Other mutations in Rasef

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Rasef	APN	4	73771425	nonsense	probably null
IGL01329:Rasef	APN	4	73727645	missense	probably damaging	1.00
IGL01517:Rasef	APN	4	73769822	missense	probably benign	0.03
IGL02465:Rasef	APN	4	73734488	missense	probably damaging	1.00
IGL02676:Rasef	APN	4	73759729	missense	possibly damaging	0.69
IGL03137:Rasef	APN	4	73734483	nonsense	probably null
IGL03403:Rasef	APN	4	73734534	missense	probably damaging	1.00
BB001:Rasef	UTSW	4	73740929	critical splice donor site	probably null
BB011:Rasef	UTSW	4	73740929	critical splice donor site	probably null
P0033:Rasef	UTSW	4	73749852	missense	probably benign	0.26
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0317:Rasef	UTSW	4	73748562	missense	probably damaging	1.00
R0686:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R0987:Rasef	UTSW	4	73734484	nonsense	probably null
R1115:Rasef	UTSW	4	73748604	missense	possibly damaging	0.85
R1511:Rasef	UTSW	4	73735748	missense	probably damaging	1.00
R1585:Rasef	UTSW	4	73740337	missense	probably damaging	1.00
R1646:Rasef	UTSW	4	73734549	missense	probably damaging	1.00
R1705:Rasef	UTSW	4	73744064	nonsense	probably null
R1918:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R1919:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R3819:Rasef	UTSW	4	73759705	missense	probably damaging	1.00
R3891:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R3892:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R4344:Rasef	UTSW	4	73745089	missense	probably damaging	1.00
R4491:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4492:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4594:Rasef	UTSW	4	73780389	missense	possibly damaging	0.47
R4915:Rasef	UTSW	4	73731459	missense	probably damaging	1.00
R5276:Rasef	UTSW	4	73735767	missense	probably null	1.00
R5359:Rasef	UTSW	4	73771328	missense	probably damaging	1.00
R5682:Rasef	UTSW	4	73740971	nonsense	probably null
R5693:Rasef	UTSW	4	73769839	missense	probably damaging	0.99
R6414:Rasef	UTSW	4	73740581	missense	probably benign	0.13
R6543:Rasef	UTSW	4	73780519	intron	probably benign
R6593:Rasef	UTSW	4	73745090	missense	probably damaging	1.00
R7078:Rasef	UTSW	4	73780389	missense	probably benign	0.01
R7083:Rasef	UTSW	4	73790984	missense	probably benign	0.26
R7106:Rasef	UTSW	4	73727627	missense	probably damaging	1.00
R7127:Rasef	UTSW	4	73744132	missense	probably damaging	1.00
R7329:Rasef	UTSW	4	73744137	missense	probably damaging	1.00
R7767:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R7891:Rasef	UTSW	4	73759698	missense	probably benign	0.00
R7891:Rasef	UTSW	4	73790964	missense	probably benign
R7924:Rasef	UTSW	4	73740929	critical splice donor site	probably null
R7997:Rasef	UTSW	4	73740562	missense	possibly damaging	0.78
R8554:Rasef	UTSW	4	73727607	missense	probably benign	0.03
R8832:Rasef	UTSW	4	73780321	intron	probably benign
R8850:Rasef	UTSW	4	73727603	missense	probably damaging	1.00
R8985:Rasef	UTSW	4	73790723	missense	possibly damaging	0.48
R9093:Rasef	UTSW	4	73780346	missense	probably benign	0.00
R9199:Rasef	UTSW	4	73740388	missense	possibly damaging	0.88
R9300:Rasef	UTSW	4	73741156	missense	probably benign
R9310:Rasef	UTSW	4	73735719	critical splice donor site	probably null
R9415:Rasef	UTSW	4	73727645	missense	probably benign	0.00
R9482:Rasef	UTSW	4	73790696	missense	probably benign	0.00
R9719:Rasef	UTSW	4	73769865	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TAATGCAACAGCACAGGACG -3'
(R):5'- AGGTCTGTTATGCTTCCTGGAAC -3'

Sequencing Primer
(F):5'- GGCATGGATTGACATACACAAAATC -3'
(R):5'- GCTTCCTGGAACTTTCAAAATGATG -3'

Posted On

2022-02-07