Incidental Mutation 'R9229:Nlrp4e'
ID 700092
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene Name NLR family, pyrin domain containing 4E
Synonyms 4930406H16Rik, Nalp4e, Nalp-epsilon
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9229 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 23301192-23362277 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23321374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 429 (S429T)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
AlphaFold Q66X19
Predicted Effect probably benign
Transcript: ENSMUST00000076470
AA Change: S429T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: S429T

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,462,378 M124I probably damaging Het
2310035C23Rik A T 1: 105,686,984 I218F possibly damaging Het
Actr10 A G 12: 70,943,485 T104A probably damaging Het
Agbl1 G A 7: 77,124,522 V1065I unknown Het
Agpat1 G T 17: 34,611,689 V196L probably null Het
Agxt2 T A 15: 10,409,511 V499E probably damaging Het
Amy2a1 T A 3: 113,532,306 probably benign Het
Ankrd35 A G 3: 96,684,899 T834A probably benign Het
Arhgef18 T A 8: 3,429,314 S51T probably benign Het
Armc12 A C 17: 28,532,371 D113A probably benign Het
Armc4 C A 18: 7,127,324 R963L possibly damaging Het
Azin1 T A 15: 38,490,402 I436F probably benign Het
B3galnt2 T C 13: 13,991,522 V334A probably damaging Het
BC055324 A T 1: 163,967,090 W512R probably damaging Het
C87414 A T 5: 93,636,230 C458* probably null Het
Ccdc68 C T 18: 69,947,132 H183Y probably benign Het
Cd180 TA TAA 13: 102,705,006 probably null Het
Cemip A T 7: 83,957,625 W795R probably damaging Het
Cenpj C T 14: 56,564,719 E130K possibly damaging Het
Ciao1 G C 2: 127,247,142 C52W probably damaging Het
Cmya5 A G 13: 93,095,668 S971P possibly damaging Het
Cnot2 A T 10: 116,549,055 L9* probably null Het
Coro1c G T 5: 113,865,686 H91N probably damaging Het
Crbn A T 6: 106,800,056 M1K probably null Het
Ctsb T A 14: 63,135,663 W90R probably damaging Het
Ctse A G 1: 131,668,124 I185V probably damaging Het
Dennd1b G T 1: 139,053,362 E105* probably null Het
Exoc5 G A 14: 49,014,253 Q679* probably null Het
Gabrg3 G A 7: 56,724,520 R433C probably damaging Het
Gm10354 A T 5: 14,977,704 S53T probably benign Het
Gm8994 A G 6: 136,329,143 I201V possibly damaging Het
Gria2 C A 3: 80,802,382 M1I probably null Het
Hist1h1t T C 13: 23,696,046 S61P probably damaging Het
Hoxb6 A T 11: 96,300,819 Q189L probably damaging Het
Hoxd10 A G 2: 74,694,256 N304S possibly damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Htra4 A T 8: 25,038,541 C112S probably damaging Het
Ide T C 19: 37,284,199 T715A Het
Ipo13 A T 4: 117,901,604 I688N probably damaging Het
Irs2 A C 8: 11,007,400 L344R probably damaging Het
Kat6a A G 8: 22,939,971 T1781A unknown Het
Lin7a G T 10: 107,411,983 V172L probably damaging Het
Lpcat1 G T 13: 73,505,531 E282D probably damaging Het
Mcf2l A G 8: 13,013,584 T963A probably benign Het
Mfsd14a G A 3: 116,645,469 A128V probably benign Het
Mfsd6 C G 1: 52,708,744 G321R probably damaging Het
Mill2 C T 7: 18,856,550 T185I probably damaging Het
Mkl2 G T 16: 13,412,321 A957S possibly damaging Het
Mpped1 C T 15: 83,854,472 T270I possibly damaging Het
Myh9 T A 15: 77,790,817 Y300F possibly damaging Het
Nlrp2 T A 7: 5,301,053 T953S possibly damaging Het
Nphp3 T A 9: 104,036,177 Y1003N probably damaging Het
Nrap T C 19: 56,321,907 K1588R probably benign Het
Olfr1118 G A 2: 87,308,821 V31I probably benign Het
Olfr1489 T A 19: 13,634,050 V313D probably damaging Het
Pam A G 1: 97,825,935 V870A probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plin3 A T 17: 56,284,315 V155E probably damaging Het
Pnpla7 G A 2: 24,983,491 V170I probably damaging Het
Ptprz1 A G 6: 22,986,284 H361R probably null Het
Pvalb T A 15: 78,202,567 I50F possibly damaging Het
Rhag G A 17: 40,831,190 A175T probably damaging Het
Slc24a4 T C 12: 102,234,724 V291A possibly damaging Het
Slc9b2 G A 3: 135,336,534 E525K probably benign Het
Smg7 A G 1: 152,845,220 F747S possibly damaging Het
Sorcs1 T G 19: 50,152,862 I1144L probably benign Het
Sox1 A T 8: 12,397,390 I344F possibly damaging Het
Spta1 A T 1: 174,240,184 E2059V probably damaging Het
Sva T A 6: 42,040,116 N52K possibly damaging Het
Sva T A 6: 42,040,118 M53K probably benign Het
Thsd7b A G 1: 129,921,290 Y913C probably damaging Het
Tiam1 A G 16: 89,837,831 S864P possibly damaging Het
Tma16 A G 8: 66,484,127 V16A probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Treml1 A G 17: 48,366,746 S262G probably benign Het
Ttn A T 2: 76,767,453 D19705E probably benign Het
Utp20 A G 10: 88,758,377 L2162P possibly damaging Het
Vmn2r60 A G 7: 42,142,299 I549V possibly damaging Het
Xpo4 T C 14: 57,613,699 N329S probably benign Het
Zfp879 T A 11: 50,833,059 H390L probably damaging Het
Zranb1 C T 7: 132,981,388 S512F probably damaging Het
Zswim8 A G 14: 20,716,325 H847R probably benign Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23343140 missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23340471 missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23321667 missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23353161 splice site probably benign
IGL01815:Nlrp4e APN 7 23321438 missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23320830 nonsense probably null
IGL02245:Nlrp4e APN 7 23320875 missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23321291 missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23321839 missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23301433 missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23301374 missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23320826 missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23353343 critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23320826 missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23355203 missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23321744 missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23320972 missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23353338 missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23321660 missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23320372 missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23321843 missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23321033 missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23320995 missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23321246 missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23355261 missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23321377 missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23340563 missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23320803 missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4387:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4389:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23321463 nonsense probably null
R4444:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23336866 missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23320979 missense probably benign
R4666:Nlrp4e UTSW 7 23336780 nonsense probably null
R4721:Nlrp4e UTSW 7 23321096 missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23321564 missense probably benign
R4758:Nlrp4e UTSW 7 23320618 missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23343100 missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23336740 missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23361893 nonsense probably null
R5277:Nlrp4e UTSW 7 23321438 missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23353173 missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23321765 missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23336891 missense probably benign 0.07
R5537:Nlrp4e UTSW 7 23320489 missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23321177 missense probably benign
R5683:Nlrp4e UTSW 7 23353272 missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23321306 missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23353172 missense probably benign
R6427:Nlrp4e UTSW 7 23320633 missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23321315 missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23336731 critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23321528 missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23321757 missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23320506 missense probably benign 0.06
R8445:Nlrp4e UTSW 7 23340540 missense probably benign 0.00
R8487:Nlrp4e UTSW 7 23321558 missense probably benign 0.00
R8906:Nlrp4e UTSW 7 23321131 missense possibly damaging 0.88
R9124:Nlrp4e UTSW 7 23320978 missense probably benign
R9167:Nlrp4e UTSW 7 23340526 missense probably benign 0.00
R9181:Nlrp4e UTSW 7 23361845 nonsense probably null
R9219:Nlrp4e UTSW 7 23321516 missense possibly damaging 0.50
R9321:Nlrp4e UTSW 7 23321330 missense probably benign
R9323:Nlrp4e UTSW 7 23321330 missense probably benign
R9325:Nlrp4e UTSW 7 23321330 missense probably benign
R9379:Nlrp4e UTSW 7 23321330 missense probably benign
R9380:Nlrp4e UTSW 7 23321330 missense probably benign
R9448:Nlrp4e UTSW 7 23301531 missense probably benign
X0022:Nlrp4e UTSW 7 23343119 missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23343178 missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23355223 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CAATCTGCCGACGTATCACTTC -3'
(R):5'- AGGCACTGATACAACTGACG -3'

Sequencing Primer
(F):5'- GACGTATCACTTCCCTGTATACCAC -3'
(R):5'- CAACTGACGTTTTATTTCTTGGGAC -3'
Posted On 2022-02-07