Incidental Mutation 'R9339:Hspg2'
ID 707361
Institutional Source Beutler Lab
Gene Symbol Hspg2
Ensembl Gene ENSMUSG00000028763
Gene Name perlecan (heparan sulfate proteoglycan 2)
Synonyms Plc, Pcn, per
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9339 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 137468769-137570630 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 137551169 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 3050 (K3050R)
Ref Sequence ENSEMBL: ENSMUSP00000131316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030547
AA Change: K3042R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763
AA Change: K3042R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1113 1156 7.5e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2056 2117 4.81e-15 SMART
IGc2 2157 2216 1.37e-10 SMART
IGc2 2251 2312 5.88e-10 SMART
low complexity region 2333 2344 N/A INTRINSIC
IGc2 2347 2408 1.97e-11 SMART
IGc2 2441 2502 1.59e-15 SMART
low complexity region 2517 2528 N/A INTRINSIC
IGc2 2538 2599 3.08e-13 SMART
IGc2 2634 2695 9.25e-17 SMART
low complexity region 2704 2728 N/A INTRINSIC
IGc2 2731 2792 1.84e-11 SMART
IGc2 2828 2889 2.11e-11 SMART
IGc2 2926 2987 3.25e-12 SMART
IG 3017 3098 3.62e-10 SMART
IGc2 3114 3180 9.05e-11 SMART
IGc2 3212 3273 2.44e-16 SMART
IGc2 3299 3360 2.26e-11 SMART
IGc2 3400 3461 6.81e-6 SMART
IGc2 3489 3550 1.59e-15 SMART
IGc2 3575 3636 2.54e-14 SMART
LamG 3672 3813 3.41e-39 SMART
EGF 3832 3866 6.91e-9 SMART
EGF 3872 3907 4.46e-3 SMART
LamG 3934 4070 4.78e-43 SMART
EGF 4092 4126 1.17e-6 SMART
EGF 4131 4161 1.87e-5 SMART
LamG 4211 4348 1.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171332
AA Change: K3050R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763
AA Change: K3050R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1114 1156 7.9e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2062 2123 4.81e-15 SMART
IGc2 2163 2222 1.37e-10 SMART
IGc2 2257 2318 5.88e-10 SMART
low complexity region 2339 2350 N/A INTRINSIC
IGc2 2353 2414 1.97e-11 SMART
IGc2 2447 2508 1.59e-15 SMART
low complexity region 2523 2534 N/A INTRINSIC
IGc2 2544 2605 3.08e-13 SMART
IGc2 2640 2701 9.25e-17 SMART
low complexity region 2710 2734 N/A INTRINSIC
IGc2 2737 2798 1.84e-11 SMART
IGc2 2836 2897 2.11e-11 SMART
IGc2 2934 2995 3.25e-12 SMART
IG 3025 3106 3.62e-10 SMART
IGc2 3122 3188 9.05e-11 SMART
IGc2 3220 3281 2.44e-16 SMART
IGc2 3307 3368 2.26e-11 SMART
IGc2 3408 3469 6.81e-6 SMART
IGc2 3497 3558 1.59e-15 SMART
IGc2 3583 3644 2.54e-14 SMART
LamG 3680 3821 3.41e-39 SMART
EGF 3840 3874 6.91e-9 SMART
EGF 3880 3915 4.46e-3 SMART
LamG 3942 4078 4.78e-43 SMART
EGF 4100 4134 1.17e-6 SMART
EGF 4139 4169 1.87e-5 SMART
LamG 4219 4356 1.33e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,849,657 E304G unknown Het
4933425L06Rik C T 13: 105,109,606 T225I probably benign Het
4933436I01Rik T A X: 67,921,083 K57* probably null Het
Aar2 T C 2: 156,550,973 V94A probably benign Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Adam25 T C 8: 40,753,874 V59A probably damaging Het
Ampd2 T C 3: 108,080,300 D103G probably damaging Het
Ankrd12 A G 17: 65,984,413 S1342P probably benign Het
Atp13a2 A G 4: 141,003,260 T739A probably benign Het
Catsperg1 T A 7: 29,195,460 N571Y probably benign Het
Cela3b A G 4: 137,425,044 I74T probably damaging Het
Cfhr1 A G 1: 139,557,555 L51P probably benign Het
Ckap5 T A 2: 91,565,755 D534E probably benign Het
Cstf3 C T 2: 104,663,433 P594L probably damaging Het
Ctdp1 A G 18: 80,449,474 L602P probably damaging Het
Defa24 A G 8: 21,734,543 T3A probably damaging Het
Dmgdh A G 13: 93,711,433 H546R probably benign Het
Dscam A G 16: 96,716,063 V882A possibly damaging Het
Dydc2 A G 14: 41,049,303 *140Q probably null Het
Ehd4 T C 2: 120,091,227 D516G possibly damaging Het
En1 T C 1: 120,607,164 V394A unknown Het
Erich3 T G 3: 154,763,235 L1108R unknown Het
Erp27 A G 6: 136,919,947 S86P probably benign Het
Esr1 A C 10: 4,746,798 S216R probably damaging Het
Fbxo40 A T 16: 36,968,924 I608N probably damaging Het
Fcna G A 2: 25,627,770 Q23* probably null Het
Foxn4 C T 5: 114,256,894 R324Q probably benign Het
Gata6 A G 18: 11,054,520 T150A probably damaging Het
Gbp2b T A 3: 142,611,417 H511Q probably benign Het
Gm4788 T A 1: 139,754,306 Y184F probably benign Het
Gpr171 C A 3: 59,097,941 V138L probably damaging Het
Grhl2 G A 15: 37,344,660 V509I probably benign Het
Gzmd G A 14: 56,130,412 P135S probably damaging Het
Hhatl C A 9: 121,789,796 C90F probably benign Het
Kcnh3 T C 15: 99,232,905 Y468H probably damaging Het
Lhfp A G 3: 53,043,470 H55R probably benign Het
Lpgat1 T C 1: 191,719,376 V38A probably benign Het
Lrrc49 A G 9: 60,602,748 I479T probably benign Het
Map1b A T 13: 99,431,062 I1717N unknown Het
Map3k20 G T 2: 72,441,872 R781S possibly damaging Het
Mcm3ap A G 10: 76,470,524 E157G probably benign Het
Mylk2 A G 2: 152,913,450 E178G probably damaging Het
Naaladl2 A G 3: 24,002,982 L605P probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Olfr1249 T C 2: 89,630,211 E229G probably damaging Het
Olfr63 T C 17: 33,269,657 V311A probably benign Het
Padi3 A T 4: 140,795,617 I348N probably benign Het
Pcdh18 T C 3: 49,754,886 D660G probably damaging Het
Pdgfra T A 5: 75,194,974 S1048R probably damaging Het
Pkhd1l1 T C 15: 44,589,553 V3958A probably damaging Het
Ppargc1b C A 18: 61,323,196 C80F probably damaging Het
Rbm28 T C 6: 29,128,675 E590G probably benign Het
Rbm47 T C 5: 66,026,483 E259G possibly damaging Het
Rint1 A G 5: 23,788,357 *37W probably null Het
Sacs G A 14: 61,205,860 R1785Q probably benign Het
Samm50 T C 15: 84,211,075 C421R probably benign Het
Scnn1b G T 7: 121,912,031 A314S probably damaging Het
Sf3b3 C A 8: 110,816,222 V868L probably benign Het
Sirt5 G T 13: 43,376,851 V136L probably benign Het
Slc1a7 T C 4: 107,993,040 V116A probably damaging Het
Slc24a4 G A 12: 102,264,379 V510M probably damaging Het
Slc35f5 T C 1: 125,589,891 I116T probably benign Het
Spata4 T C 8: 54,600,864 S22P probably benign Het
Sqstm1 A G 11: 50,200,898 V324A probably benign Het
Stmnd1 G A 13: 46,299,603 A252T probably benign Het
Tbl1xr1 C A 3: 22,203,986 N470K possibly damaging Het
Thap12 T C 7: 98,715,116 S164P possibly damaging Het
Thsd1 A G 8: 22,243,882 Y315C probably damaging Het
Tnni2 C A 7: 142,443,935 D102E probably damaging Het
Trav7n-4 A C 14: 53,091,392 N16T probably benign Het
Trpm7 T C 2: 126,823,986 K900R probably benign Het
Tspoap1 T A 11: 87,778,013 C1371S probably benign Het
Tssk5 A G 15: 76,372,956 M242T possibly damaging Het
Ubn2 A G 6: 38,483,144 I607V probably benign Het
Ubr2 A T 17: 46,973,939 V551E probably benign Het
Vipr2 A G 12: 116,094,724 N87S probably damaging Het
Vmn2r18 T A 5: 151,561,667 K787N probably damaging Het
Wwc2 A T 8: 47,900,824 W92R probably damaging Het
Zfp141 A G 7: 42,476,215 Y278H probably damaging Het
Zfp827 T C 8: 79,118,258 S686P probably benign Het
Other mutations in Hspg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hspg2 APN 4 137528820 missense probably damaging 1.00
IGL00339:Hspg2 APN 4 137539195 missense probably damaging 1.00
IGL00943:Hspg2 APN 4 137562201 missense probably benign 0.15
IGL00970:Hspg2 APN 4 137542590 missense probably benign 0.09
IGL01011:Hspg2 APN 4 137559335 missense probably damaging 1.00
IGL01148:Hspg2 APN 4 137546658 missense probably benign 0.11
IGL01333:Hspg2 APN 4 137540314 missense probably damaging 1.00
IGL01367:Hspg2 APN 4 137538489 missense probably damaging 1.00
IGL01455:Hspg2 APN 4 137553817 missense probably damaging 1.00
IGL01540:Hspg2 APN 4 137519706 missense probably damaging 1.00
IGL01578:Hspg2 APN 4 137539183 missense probably damaging 1.00
IGL01603:Hspg2 APN 4 137552803 missense probably damaging 1.00
IGL01632:Hspg2 APN 4 137514773 missense probably damaging 1.00
IGL01658:Hspg2 APN 4 137564926 missense probably damaging 1.00
IGL01760:Hspg2 APN 4 137512671 missense possibly damaging 0.60
IGL01976:Hspg2 APN 4 137561926 missense probably damaging 1.00
IGL02024:Hspg2 APN 4 137540073 missense probably damaging 1.00
IGL02033:Hspg2 APN 4 137552254 missense probably benign
IGL02051:Hspg2 APN 4 137568389 unclassified probably benign
IGL02124:Hspg2 APN 4 137518814 splice site probably null
IGL02128:Hspg2 APN 4 137564016 missense probably damaging 1.00
IGL02177:Hspg2 APN 4 137515316 missense probably damaging 1.00
IGL02230:Hspg2 APN 4 137518645 missense probably damaging 1.00
IGL02266:Hspg2 APN 4 137510577 missense probably damaging 1.00
IGL02313:Hspg2 APN 4 137508389 missense probably benign 0.03
IGL02477:Hspg2 APN 4 137544512 splice site probably benign
IGL02514:Hspg2 APN 4 137569576 missense probably benign 0.09
IGL02613:Hspg2 APN 4 137544420 missense probably damaging 1.00
IGL02625:Hspg2 APN 4 137512642 missense probably damaging 1.00
IGL02646:Hspg2 APN 4 137551848 missense possibly damaging 0.60
IGL02651:Hspg2 APN 4 137557445 splice site probably benign
IGL02701:Hspg2 APN 4 137557174 missense probably damaging 0.96
IGL02833:Hspg2 APN 4 137555130 missense probably benign 0.00
IGL02985:Hspg2 APN 4 137507803 missense probably damaging 1.00
IGL03040:Hspg2 APN 4 137561825 critical splice donor site probably null
IGL03181:Hspg2 APN 4 137515937 missense probably damaging 1.00
IGL03349:Hspg2 APN 4 137560522 splice site probably benign
G1patch:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
PIT4305001:Hspg2 UTSW 4 137550373 missense possibly damaging 0.55
R0006:Hspg2 UTSW 4 137519931 missense probably damaging 1.00
R0036:Hspg2 UTSW 4 137542849 missense probably damaging 1.00
R0109:Hspg2 UTSW 4 137562201 missense probably benign 0.15
R0131:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0131:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0132:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0245:Hspg2 UTSW 4 137514722 missense probably damaging 1.00
R0388:Hspg2 UTSW 4 137511158 missense probably damaging 1.00
R0389:Hspg2 UTSW 4 137515423 missense possibly damaging 0.53
R0468:Hspg2 UTSW 4 137533529 missense probably damaging 1.00
R0480:Hspg2 UTSW 4 137550024 missense probably damaging 1.00
R0546:Hspg2 UTSW 4 137502294 missense probably benign
R0599:Hspg2 UTSW 4 137512401 missense probably damaging 0.98
R0652:Hspg2 UTSW 4 137514722 missense probably damaging 1.00
R0671:Hspg2 UTSW 4 137553280 missense probably damaging 1.00
R0760:Hspg2 UTSW 4 137512349 missense probably damaging 1.00
R0883:Hspg2 UTSW 4 137541440 missense probably benign 0.00
R1403:Hspg2 UTSW 4 137540100 missense possibly damaging 0.90
R1417:Hspg2 UTSW 4 137517636 missense probably benign
R1497:Hspg2 UTSW 4 137548096 missense probably damaging 0.98
R1509:Hspg2 UTSW 4 137511241 splice site probably benign
R1625:Hspg2 UTSW 4 137518971 missense probably benign 0.23
R1630:Hspg2 UTSW 4 137518435 missense probably damaging 1.00
R1651:Hspg2 UTSW 4 137533437 nonsense probably null
R1699:Hspg2 UTSW 4 137548012 splice site probably null
R1703:Hspg2 UTSW 4 137559151 missense probably damaging 1.00
R1761:Hspg2 UTSW 4 137514673 missense possibly damaging 0.90
R1775:Hspg2 UTSW 4 137520156 missense probably damaging 0.99
R1779:Hspg2 UTSW 4 137518509 missense probably damaging 1.00
R1843:Hspg2 UTSW 4 137545567 missense probably damaging 1.00
R1891:Hspg2 UTSW 4 137565490 missense probably damaging 1.00
R1930:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R1931:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R1942:Hspg2 UTSW 4 137542552 missense possibly damaging 0.67
R1959:Hspg2 UTSW 4 137564895 missense probably damaging 1.00
R2042:Hspg2 UTSW 4 137568366 missense probably damaging 1.00
R2062:Hspg2 UTSW 4 137559367 missense possibly damaging 0.79
R2098:Hspg2 UTSW 4 137520109 missense probably damaging 1.00
R2158:Hspg2 UTSW 4 137517604 missense probably damaging 1.00
R2280:Hspg2 UTSW 4 137522043 missense probably damaging 1.00
R2890:Hspg2 UTSW 4 137549574 missense probably damaging 1.00
R2927:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R3428:Hspg2 UTSW 4 137555290 missense probably damaging 1.00
R3744:Hspg2 UTSW 4 137565504 splice site probably benign
R3873:Hspg2 UTSW 4 137539349 missense probably damaging 1.00
R3874:Hspg2 UTSW 4 137539349 missense probably damaging 1.00
R3917:Hspg2 UTSW 4 137559314 missense probably damaging 1.00
R3932:Hspg2 UTSW 4 137515568 missense probably damaging 0.99
R3933:Hspg2 UTSW 4 137515568 missense probably damaging 0.99
R4134:Hspg2 UTSW 4 137556657 missense probably damaging 0.99
R4272:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4273:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4274:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4275:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4288:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4289:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4354:Hspg2 UTSW 4 137468911 missense probably benign 0.17
R4355:Hspg2 UTSW 4 137529418 missense probably damaging 0.98
R4400:Hspg2 UTSW 4 137548122 missense probably benign 0.01
R4411:Hspg2 UTSW 4 137562224 missense probably benign
R4421:Hspg2 UTSW 4 137548122 missense probably benign 0.01
R4592:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137539575 missense possibly damaging 0.80
R4619:Hspg2 UTSW 4 137546573 missense probably damaging 1.00
R4658:Hspg2 UTSW 4 137533730 missense probably damaging 1.00
R4667:Hspg2 UTSW 4 137539645 missense possibly damaging 0.90
R4724:Hspg2 UTSW 4 137522127 missense probably damaging 0.96
R4739:Hspg2 UTSW 4 137570073 unclassified probably benign
R4793:Hspg2 UTSW 4 137529473 missense possibly damaging 0.95
R4826:Hspg2 UTSW 4 137565395 missense probably damaging 1.00
R4838:Hspg2 UTSW 4 137541666 missense possibly damaging 0.53
R4896:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4926:Hspg2 UTSW 4 137542530 missense probably damaging 1.00
R4939:Hspg2 UTSW 4 137508031 missense probably damaging 1.00
R5032:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R5033:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R5071:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R5072:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R5114:Hspg2 UTSW 4 137511926 missense probably damaging 1.00
R5177:Hspg2 UTSW 4 137518772 missense probably damaging 1.00
R5223:Hspg2 UTSW 4 137543914 missense probably damaging 1.00
R5433:Hspg2 UTSW 4 137528794 splice site probably null
R5529:Hspg2 UTSW 4 137551828 missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137520551 missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137542825 missense probably benign 0.17
R5546:Hspg2 UTSW 4 137548174 critical splice donor site probably null
R5728:Hspg2 UTSW 4 137542766 missense possibly damaging 0.95
R5764:Hspg2 UTSW 4 137561721 missense probably damaging 1.00
R5920:Hspg2 UTSW 4 137553782 missense probably damaging 1.00
R5934:Hspg2 UTSW 4 137518772 missense probably damaging 1.00
R6074:Hspg2 UTSW 4 137540735 missense probably benign
R6164:Hspg2 UTSW 4 137514655 missense possibly damaging 0.89
R6175:Hspg2 UTSW 4 137569518 missense probably damaging 1.00
R6217:Hspg2 UTSW 4 137540248 missense probably damaging 0.99
R6262:Hspg2 UTSW 4 137519686 missense probably damaging 1.00
R6299:Hspg2 UTSW 4 137544705 missense probably damaging 1.00
R6333:Hspg2 UTSW 4 137561955 missense probably damaging 1.00
R6371:Hspg2 UTSW 4 137541695 missense probably damaging 1.00
R6430:Hspg2 UTSW 4 137539396 missense probably damaging 1.00
R6498:Hspg2 UTSW 4 137507801 missense possibly damaging 0.46
R6522:Hspg2 UTSW 4 137555275 missense probably damaging 1.00
R6680:Hspg2 UTSW 4 137565737 missense probably benign 0.18
R6724:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6725:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6762:Hspg2 UTSW 4 137551803 missense possibly damaging 0.83
R6785:Hspg2 UTSW 4 137508398 missense probably damaging 0.99
R6788:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6931:Hspg2 UTSW 4 137540720 missense probably damaging 1.00
R6959:Hspg2 UTSW 4 137519289 missense probably benign 0.45
R6968:Hspg2 UTSW 4 137535156 missense probably damaging 1.00
R6988:Hspg2 UTSW 4 137528890 missense probably damaging 1.00
R7021:Hspg2 UTSW 4 137542269 missense possibly damaging 0.69
R7089:Hspg2 UTSW 4 137544366 missense possibly damaging 0.51
R7107:Hspg2 UTSW 4 137510652 missense probably damaging 1.00
R7141:Hspg2 UTSW 4 137552116 missense probably damaging 1.00
R7161:Hspg2 UTSW 4 137514719 missense probably damaging 1.00
R7189:Hspg2 UTSW 4 137533561 critical splice donor site probably null
R7238:Hspg2 UTSW 4 137508393 missense probably damaging 1.00
R7253:Hspg2 UTSW 4 137519946 missense probably benign 0.15
R7278:Hspg2 UTSW 4 137551125 missense probably damaging 0.98
R7287:Hspg2 UTSW 4 137529556 missense probably benign 0.00
R7390:Hspg2 UTSW 4 137539179 missense probably damaging 1.00
R7436:Hspg2 UTSW 4 137515664 missense probably damaging 0.99
R7479:Hspg2 UTSW 4 137539403 missense probably benign 0.17
R7516:Hspg2 UTSW 4 137542620 missense possibly damaging 0.94
R7540:Hspg2 UTSW 4 137541440 missense possibly damaging 0.51
R7603:Hspg2 UTSW 4 137548368 missense probably damaging 1.00
R7603:Hspg2 UTSW 4 137557192 missense possibly damaging 0.91
R7625:Hspg2 UTSW 4 137564938 missense probably damaging 1.00
R7696:Hspg2 UTSW 4 137511966 missense possibly damaging 0.78
R7767:Hspg2 UTSW 4 137511866 missense probably damaging 1.00
R7815:Hspg2 UTSW 4 137512464 missense probably damaging 1.00
R7825:Hspg2 UTSW 4 137558849 missense probably damaging 1.00
R7863:Hspg2 UTSW 4 137564824 missense probably benign 0.03
R7885:Hspg2 UTSW 4 137516837 missense probably damaging 1.00
R7899:Hspg2 UTSW 4 137548116 missense possibly damaging 0.72
R7937:Hspg2 UTSW 4 137550932 missense probably benign 0.01
R7975:Hspg2 UTSW 4 137555221 missense probably benign 0.26
R8078:Hspg2 UTSW 4 137508022 missense probably damaging 1.00
R8285:Hspg2 UTSW 4 137512663 missense probably benign 0.18
R8314:Hspg2 UTSW 4 137539675 missense probably benign 0.12
R8322:Hspg2 UTSW 4 137518979 missense possibly damaging 0.88
R8323:Hspg2 UTSW 4 137518979 missense possibly damaging 0.88
R8324:Hspg2 UTSW 4 137518979 missense possibly damaging 0.88
R8341:Hspg2 UTSW 4 137518979 missense possibly damaging 0.88
R8383:Hspg2 UTSW 4 137544370 missense possibly damaging 0.66
R8425:Hspg2 UTSW 4 137550867 nonsense probably null
R8491:Hspg2 UTSW 4 137553719 missense probably benign 0.00
R8525:Hspg2 UTSW 4 137539448 missense probably damaging 0.98
R8978:Hspg2 UTSW 4 137564030 missense probably benign 0.09
R9152:Hspg2 UTSW 4 137522565 missense possibly damaging 0.89
R9166:Hspg2 UTSW 4 137542874 missense probably damaging 1.00
R9175:Hspg2 UTSW 4 137529346 missense probably damaging 0.98
R9210:Hspg2 UTSW 4 137562479 missense probably benign 0.05
R9221:Hspg2 UTSW 4 137560415 missense possibly damaging 0.79
R9325:Hspg2 UTSW 4 137538241 missense probably damaging 1.00
R9340:Hspg2 UTSW 4 137569516 missense probably damaging 1.00
R9358:Hspg2 UTSW 4 137517598 missense probably damaging 1.00
R9451:Hspg2 UTSW 4 137511069 missense probably damaging 1.00
R9534:Hspg2 UTSW 4 137540761 missense probably benign
R9656:Hspg2 UTSW 4 137551885 missense probably benign
R9664:Hspg2 UTSW 4 137539576 missense probably benign 0.03
R9695:Hspg2 UTSW 4 137538390 missense probably damaging 1.00
R9741:Hspg2 UTSW 4 137512651 missense probably damaging 1.00
V5622:Hspg2 UTSW 4 137533738 missense probably damaging 0.99
V5622:Hspg2 UTSW 4 137533738 missense probably damaging 0.99
X0028:Hspg2 UTSW 4 137550391 missense probably benign
Z1177:Hspg2 UTSW 4 137550467 missense probably damaging 1.00
Z1177:Hspg2 UTSW 4 137564518 missense probably damaging 0.99
Z1177:Hspg2 UTSW 4 137568373 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AAACTCTTCCTTCCGTGAGTGC -3'
(R):5'- TGGGACTTGATCAAAGATGGC -3'

Sequencing Primer
(F):5'- TGCCAGGAGTGGGGAAG -3'
(R):5'- CAGAAAGTGGGGGTCCTTG -3'
Posted On 2022-04-18