Incidental Mutation 'R9339:Samm50'
ID 707406
Institutional Source Beutler Lab
Gene Symbol Samm50
Ensembl Gene ENSMUSG00000022437
Gene Name SAMM50 sorting and assembly machinery component
Synonyms 1110030L07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock # R9339 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 84192241-84217267 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84211075 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 421 (C421R)
Ref Sequence ENSEMBL: ENSMUSP00000023071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023071]
AlphaFold Q8BGH2
Predicted Effect probably benign
Transcript: ENSMUST00000023071
AA Change: C421R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023071
Gene: ENSMUSG00000022437
AA Change: C421R

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:Bac_surface_Ag 151 468 1.8e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,849,657 E304G unknown Het
4933425L06Rik C T 13: 105,109,606 T225I probably benign Het
4933436I01Rik T A X: 67,921,083 K57* probably null Het
Aar2 T C 2: 156,550,973 V94A probably benign Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Adam25 T C 8: 40,753,874 V59A probably damaging Het
Ampd2 T C 3: 108,080,300 D103G probably damaging Het
Ankrd12 A G 17: 65,984,413 S1342P probably benign Het
Atp13a2 A G 4: 141,003,260 T739A probably benign Het
Catsperg1 T A 7: 29,195,460 N571Y probably benign Het
Cela3b A G 4: 137,425,044 I74T probably damaging Het
Cfhr1 A G 1: 139,557,555 L51P probably benign Het
Ckap5 T A 2: 91,565,755 D534E probably benign Het
Cstf3 C T 2: 104,663,433 P594L probably damaging Het
Ctdp1 A G 18: 80,449,474 L602P probably damaging Het
Defa24 A G 8: 21,734,543 T3A probably damaging Het
Dmgdh A G 13: 93,711,433 H546R probably benign Het
Dscam A G 16: 96,716,063 V882A possibly damaging Het
Dydc2 A G 14: 41,049,303 *140Q probably null Het
Ehd4 T C 2: 120,091,227 D516G possibly damaging Het
En1 T C 1: 120,607,164 V394A unknown Het
Erich3 T G 3: 154,763,235 L1108R unknown Het
Erp27 A G 6: 136,919,947 S86P probably benign Het
Esr1 A C 10: 4,746,798 S216R probably damaging Het
Fbxo40 A T 16: 36,968,924 I608N probably damaging Het
Fcna G A 2: 25,627,770 Q23* probably null Het
Foxn4 C T 5: 114,256,894 R324Q probably benign Het
Gata6 A G 18: 11,054,520 T150A probably damaging Het
Gbp2b T A 3: 142,611,417 H511Q probably benign Het
Gm4788 T A 1: 139,754,306 Y184F probably benign Het
Gpr171 C A 3: 59,097,941 V138L probably damaging Het
Grhl2 G A 15: 37,344,660 V509I probably benign Het
Gzmd G A 14: 56,130,412 P135S probably damaging Het
Hhatl C A 9: 121,789,796 C90F probably benign Het
Hspg2 A G 4: 137,551,169 K3050R probably benign Het
Kcnh3 T C 15: 99,232,905 Y468H probably damaging Het
Lhfp A G 3: 53,043,470 H55R probably benign Het
Lpgat1 T C 1: 191,719,376 V38A probably benign Het
Lrrc49 A G 9: 60,602,748 I479T probably benign Het
Map1b A T 13: 99,431,062 I1717N unknown Het
Map3k20 G T 2: 72,441,872 R781S possibly damaging Het
Mcm3ap A G 10: 76,470,524 E157G probably benign Het
Mylk2 A G 2: 152,913,450 E178G probably damaging Het
Naaladl2 A G 3: 24,002,982 L605P probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Olfr1249 T C 2: 89,630,211 E229G probably damaging Het
Olfr63 T C 17: 33,269,657 V311A probably benign Het
Padi3 A T 4: 140,795,617 I348N probably benign Het
Pcdh18 T C 3: 49,754,886 D660G probably damaging Het
Pdgfra T A 5: 75,194,974 S1048R probably damaging Het
Pkhd1l1 T C 15: 44,589,553 V3958A probably damaging Het
Ppargc1b C A 18: 61,323,196 C80F probably damaging Het
Rbm28 T C 6: 29,128,675 E590G probably benign Het
Rbm47 T C 5: 66,026,483 E259G possibly damaging Het
Rint1 A G 5: 23,788,357 *37W probably null Het
Sacs G A 14: 61,205,860 R1785Q probably benign Het
Scnn1b G T 7: 121,912,031 A314S probably damaging Het
Sf3b3 C A 8: 110,816,222 V868L probably benign Het
Sirt5 G T 13: 43,376,851 V136L probably benign Het
Slc1a7 T C 4: 107,993,040 V116A probably damaging Het
Slc24a4 G A 12: 102,264,379 V510M probably damaging Het
Spata4 T C 8: 54,600,864 S22P probably benign Het
Sqstm1 A G 11: 50,200,898 V324A probably benign Het
Stmnd1 G A 13: 46,299,603 A252T probably benign Het
Tbl1xr1 C A 3: 22,203,986 N470K possibly damaging Het
Thap12 T C 7: 98,715,116 S164P possibly damaging Het
Thsd1 A G 8: 22,243,882 Y315C probably damaging Het
Tnni2 C A 7: 142,443,935 D102E probably damaging Het
Trav7n-4 A C 14: 53,091,392 N16T probably benign Het
Trpm7 T C 2: 126,823,986 K900R probably benign Het
Tspoap1 T A 11: 87,778,013 C1371S probably benign Het
Tssk5 A G 15: 76,372,956 M242T possibly damaging Het
Ubn2 A G 6: 38,483,144 I607V probably benign Het
Ubr2 A T 17: 46,973,939 V551E probably benign Het
Vipr2 A G 12: 116,094,724 N87S probably damaging Het
Vmn2r18 T A 5: 151,561,667 K787N probably damaging Het
Wwc2 A T 8: 47,900,824 W92R probably damaging Het
Zfp141 A G 7: 42,476,215 Y278H probably damaging Het
Zfp827 T C 8: 79,118,258 S686P probably benign Het
Other mutations in Samm50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Samm50 APN 15 84200375 missense possibly damaging 0.82
IGL01061:Samm50 APN 15 84202254 missense probably benign 0.00
IGL01549:Samm50 APN 15 84202781 missense probably benign
IGL01586:Samm50 APN 15 84195838 missense probably benign 0.03
IGL02494:Samm50 APN 15 84195814 missense probably benign
IGL02607:Samm50 APN 15 84207838 missense probably benign 0.09
IGL03244:Samm50 APN 15 84214140 missense probably benign 0.09
IGL03340:Samm50 APN 15 84198663 critical splice donor site probably null
R0591:Samm50 UTSW 15 84211168 missense probably benign
R0634:Samm50 UTSW 15 84214171 synonymous silent
R1780:Samm50 UTSW 15 84211127 missense probably damaging 0.99
R2192:Samm50 UTSW 15 84200424 critical splice donor site probably null
R2205:Samm50 UTSW 15 84202314 missense probably benign 0.01
R3800:Samm50 UTSW 15 84192374 missense probably damaging 0.99
R4285:Samm50 UTSW 15 84197012 missense probably damaging 1.00
R4333:Samm50 UTSW 15 84202830 missense probably benign 0.02
R4780:Samm50 UTSW 15 84210610 missense possibly damaging 0.88
R5223:Samm50 UTSW 15 84200630 missense probably benign 0.07
R5639:Samm50 UTSW 15 84214128 missense probably benign 0.22
R6258:Samm50 UTSW 15 84200311 missense probably damaging 1.00
R6258:Samm50 UTSW 15 84200312 missense probably damaging 0.98
R6437:Samm50 UTSW 15 84204097 critical splice donor site probably null
R6452:Samm50 UTSW 15 84204097 critical splice donor site probably benign
R6715:Samm50 UTSW 15 84211058 missense probably benign
R6957:Samm50 UTSW 15 84198649 missense probably damaging 1.00
R7409:Samm50 UTSW 15 84197030 missense probably benign 0.32
R7459:Samm50 UTSW 15 84195856 critical splice donor site probably null
R7706:Samm50 UTSW 15 84200880 splice site probably null
R7910:Samm50 UTSW 15 84214145 missense possibly damaging 0.49
R8421:Samm50 UTSW 15 84210585 missense probably benign 0.04
R8443:Samm50 UTSW 15 84210501 missense possibly damaging 0.82
R9457:Samm50 UTSW 15 84207841 missense probably damaging 1.00
X0067:Samm50 UTSW 15 84202833 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAACCTTCAGCTGGCTGTG -3'
(R):5'- GGACCGCATGCTCTCATTCTTTAG -3'

Sequencing Primer
(F):5'- CAGCTGGCTGTGGAAGAGTC -3'
(R):5'- GACCTATACTGAAGTGGCCATCTCG -3'
Posted On 2022-04-18