Incidental Mutation 'R9611:Col4a3'
ID 724194
Institutional Source Beutler Lab
Gene Symbol Col4a3
Ensembl Gene ENSMUSG00000079465
Gene Name collagen, type IV, alpha 3
Synonyms alpha3(IV), tumstatin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9611 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 82586921-82722059 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82700297 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1207 (M1207V)
Ref Sequence ENSEMBL: ENSMUSP00000109084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113457]
AlphaFold Q9QZS0
Predicted Effect unknown
Transcript: ENSMUST00000113457
AA Change: M1207V
SMART Domains Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465
AA Change: M1207V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 41 102 9.6e-11 PFAM
Pfam:Collagen 97 164 3.6e-11 PFAM
Pfam:Collagen 164 223 3.6e-9 PFAM
low complexity region 233 243 N/A INTRINSIC
Pfam:Collagen 284 344 2.4e-10 PFAM
low complexity region 368 393 N/A INTRINSIC
Pfam:Collagen 415 477 5e-10 PFAM
Pfam:Collagen 481 545 1e-9 PFAM
low complexity region 550 585 N/A INTRINSIC
Pfam:Collagen 588 653 8.9e-9 PFAM
Pfam:Collagen 682 744 1.1e-8 PFAM
Pfam:Collagen 743 807 6.9e-10 PFAM
Pfam:Collagen 786 847 1.5e-8 PFAM
Pfam:Collagen 845 904 1.5e-10 PFAM
Pfam:Collagen 887 946 4.1e-10 PFAM
Pfam:Collagen 948 1006 8.1e-11 PFAM
Pfam:Collagen 997 1061 2.8e-10 PFAM
Pfam:Collagen 1057 1120 2.5e-10 PFAM
Pfam:Collagen 1114 1176 1.7e-9 PFAM
Pfam:Collagen 1174 1233 1.1e-9 PFAM
Pfam:Collagen 1232 1295 6.9e-9 PFAM
low complexity region 1326 1347 N/A INTRINSIC
Pfam:Collagen 1377 1439 4.9e-11 PFAM
C4 1444 1553 3.77e-70 SMART
C4 1554 1667 3.28e-70 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T C 2: 91,304,782 D111G probably damaging Het
Adamts19 A T 18: 58,890,327 T265S probably benign Het
Ahnak T A 19: 9,011,798 L3482Q probably damaging Het
Apopt1 T G 12: 111,733,674 Y163D probably damaging Het
Arhgef5 A G 6: 43,280,956 I1311M probably damaging Het
Bcr T A 10: 75,154,911 Y750N probably damaging Het
Bcr T A 10: 75,154,913 Y750* probably null Het
Btbd16 T A 7: 130,805,865 M295K probably benign Het
Ccdc88a T C 11: 29,477,316 L1007P possibly damaging Het
Cnep1r1 A G 8: 88,133,829 *126W probably null Het
Cntnap5b C A 1: 99,967,210 P69Q probably damaging Het
Colgalt2 T A 1: 152,484,994 W261R probably damaging Het
Cstf1 T A 2: 172,373,064 I35N probably benign Het
Cul9 A G 17: 46,519,897 L1690P possibly damaging Het
Dscaml1 C A 9: 45,668,224 N356K possibly damaging Het
Ecm2 A G 13: 49,527,740 I450M probably damaging Het
Ecm2 A G 13: 49,515,042 N74D probably benign Het
Emc1 T A 4: 139,363,724 D460E probably benign Het
Fam160b2 T C 14: 70,586,818 Y493C probably benign Het
Fmo5 C T 3: 97,641,773 R246C possibly damaging Het
Fyco1 T C 9: 123,828,520 T864A possibly damaging Het
Galk2 T C 2: 125,975,298 Y336H probably damaging Het
Gcsh T A 8: 116,993,386 Y14F probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Gucy2g T C 19: 55,206,173 I937M probably damaging Het
Hsp90ab1 T C 17: 45,569,674 I370M possibly damaging Het
Hypk T C 2: 121,457,673 S72P probably damaging Het
Ighv1-26 T C 12: 114,788,586 Y46C probably damaging Het
Kctd13 G T 7: 126,945,008 G293C probably damaging Het
Kmt2d CTGCTGTTGCTG CTGCTG 15: 98,845,173 probably benign Het
Kmt2d CTGTTG CTG 15: 98,845,176 probably benign Het
Krt13 T C 11: 100,121,492 S2G probably benign Het
Mark4 C A 7: 19,433,413 R467L possibly damaging Het
Mrps33 T A 6: 39,802,488 K91M probably damaging Het
Olfr209 A C 16: 59,361,879 I113S probably benign Het
Olfr566 T G 7: 102,856,940 H114P probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phldb3 G A 7: 24,628,947 V639M probably damaging Het
Pigyl A T 9: 22,158,203 H70L probably damaging Het
Pip4k2c A C 10: 127,200,200 L266R probably damaging Het
Plg T C 17: 12,390,326 Y173H probably benign Het
Pmp22 G T 11: 63,133,239 V25F probably benign Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Ppp1r16b T A 2: 158,696,078 Y40N probably damaging Het
Prl5a1 A G 13: 28,145,509 E57G possibly damaging Het
Prpf3 G A 3: 95,851,619 R74* probably null Het
Psmb10 A G 8: 105,937,512 F75S probably benign Het
Ptprm C A 17: 66,693,488 R1167M probably damaging Het
Rmnd5b T C 11: 51,627,042 I162V probably damaging Het
Sik1 T A 17: 31,854,272 K70M probably damaging Het
Slc44a4 C T 17: 34,928,817 S611F probably benign Het
St18 T C 1: 6,802,923 V294A probably benign Het
Stk32a A G 18: 43,297,555 I177V probably benign Het
Syne2 T C 12: 76,033,686 F58S probably benign Het
Tcf7l2 A G 19: 55,910,606 D215G probably null Het
Tcirg1 A T 19: 3,903,400 F149Y probably benign Het
Tex14 T A 11: 87,486,258 F143I probably damaging Het
Tjp3 A G 10: 81,283,577 V26A possibly damaging Het
Tnfaip8 ACACACTCTC AC 18: 50,046,841 probably benign Het
Tpx2 T A 2: 152,873,204 V115D probably benign Het
Tubb2b C A 13: 34,127,759 K350N probably damaging Het
Vps13b G T 15: 35,642,409 G1389V possibly damaging Het
Vps39 T C 2: 120,342,004 R183G probably damaging Het
Wdr47 A T 3: 108,611,413 E72D probably damaging Het
Wnk4 G T 11: 101,268,424 E556* probably null Het
Xpo7 T A 14: 70,688,177 E474V probably benign Het
Zfat A G 15: 68,179,806 V713A possibly damaging Het
Zfp189 G T 4: 49,530,058 C387F probably damaging Het
Zmiz1 T C 14: 25,650,598 V502A probably benign Het
Other mutations in Col4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Col4a3 APN 1 82697754 missense unknown
IGL00847:Col4a3 APN 1 82717869 missense probably damaging 1.00
IGL01011:Col4a3 APN 1 82682301 missense unknown
IGL01102:Col4a3 APN 1 82669720 missense unknown
IGL01102:Col4a3 APN 1 82670255 missense unknown
IGL02071:Col4a3 APN 1 82660887 critical splice donor site probably null
IGL02244:Col4a3 APN 1 82669771 splice site probably benign
IGL02380:Col4a3 APN 1 82672788 splice site probably benign
IGL02431:Col4a3 APN 1 82679623 nonsense probably null
IGL02466:Col4a3 APN 1 82670192 missense unknown
IGL02694:Col4a3 APN 1 82710794 unclassified probably benign
IGL02709:Col4a3 APN 1 82679112 missense unknown
IGL02752:Col4a3 APN 1 82660225 missense unknown
IGL02792:Col4a3 APN 1 82718803 missense probably damaging 1.00
IGL03203:Col4a3 APN 1 82672639 nonsense probably null
IGL03218:Col4a3 APN 1 82643206 splice site probably benign
FR4976:Col4a3 UTSW 1 82718906 frame shift probably null
PIT4260001:Col4a3 UTSW 1 82682761 missense unknown
PIT4515001:Col4a3 UTSW 1 82682303 missense unknown
R0035:Col4a3 UTSW 1 82672753 missense unknown
R0099:Col4a3 UTSW 1 82717993 missense probably benign 0.41
R0433:Col4a3 UTSW 1 82670219 missense unknown
R0573:Col4a3 UTSW 1 82716363 missense possibly damaging 0.83
R0606:Col4a3 UTSW 1 82672586 splice site probably benign
R0715:Col4a3 UTSW 1 82652158 splice site probably benign
R0961:Col4a3 UTSW 1 82708576 splice site probably benign
R1257:Col4a3 UTSW 1 82716365 missense probably damaging 1.00
R1264:Col4a3 UTSW 1 82643301 splice site probably benign
R1373:Col4a3 UTSW 1 82690087 splice site probably benign
R1694:Col4a3 UTSW 1 82690663 splice site probably null
R1895:Col4a3 UTSW 1 82679108 missense unknown
R1925:Col4a3 UTSW 1 82700373 missense unknown
R1925:Col4a3 UTSW 1 82711874 unclassified probably benign
R2033:Col4a3 UTSW 1 82718011 intron probably benign
R2044:Col4a3 UTSW 1 82696319 missense unknown
R2122:Col4a3 UTSW 1 82654957 missense unknown
R2282:Col4a3 UTSW 1 82708638 missense unknown
R2318:Col4a3 UTSW 1 82648569 splice site probably null
R2421:Col4a3 UTSW 1 82670275 splice site probably benign
R2517:Col4a3 UTSW 1 82680710 missense unknown
R2965:Col4a3 UTSW 1 82648600 missense unknown
R3085:Col4a3 UTSW 1 82651258 missense unknown
R3150:Col4a3 UTSW 1 82657137 splice site probably null
R3947:Col4a3 UTSW 1 82715332 missense probably damaging 1.00
R4756:Col4a3 UTSW 1 82716297 critical splice acceptor site probably null
R4910:Col4a3 UTSW 1 82672679 missense unknown
R4928:Col4a3 UTSW 1 82710977 unclassified probably benign
R5044:Col4a3 UTSW 1 82666546 missense unknown
R5557:Col4a3 UTSW 1 82715247 unclassified probably benign
R5761:Col4a3 UTSW 1 82716057 nonsense probably null
R5970:Col4a3 UTSW 1 82716329 missense possibly damaging 0.76
R6576:Col4a3 UTSW 1 82708574 splice site probably null
R6583:Col4a3 UTSW 1 82641476 missense unknown
R6675:Col4a3 UTSW 1 82668925 missense unknown
R7170:Col4a3 UTSW 1 82715909 splice site probably null
R7592:Col4a3 UTSW 1 82648617 missense unknown
R7624:Col4a3 UTSW 1 82718884 missense probably benign
R7994:Col4a3 UTSW 1 82662906 missense unknown
R8127:Col4a3 UTSW 1 82649760 missense unknown
R8702:Col4a3 UTSW 1 82710979 missense unknown
R8865:Col4a3 UTSW 1 82669762 critical splice donor site probably null
R8973:Col4a3 UTSW 1 82715331 missense probably benign 0.11
R9665:Col4a3 UTSW 1 82690580 missense unknown
R9765:Col4a3 UTSW 1 82668957 nonsense probably null
X0067:Col4a3 UTSW 1 82716159 missense probably damaging 0.99
Z1177:Col4a3 UTSW 1 82690039 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCTAGATCAACACCTAGTCAG -3'
(R):5'- AACGACATCTCCCTGAGGAC -3'

Sequencing Primer
(F):5'- CTAGATCAACACCTAGTCAGAGGAAG -3'
(R):5'- ATCTCCCTGAGGACAGTCAG -3'
Posted On 2022-09-12