Incidental Mutation 'R8973:Col4a3'
ID 683217
Institutional Source Beutler Lab
Gene Symbol Col4a3
Ensembl Gene ENSMUSG00000079465
Gene Name collagen, type IV, alpha 3
Synonyms alpha3(IV), tumstatin
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8973 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 82586921-82722059 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 82715331 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1446 (I1446L)
Ref Sequence ENSEMBL: ENSMUSP00000109084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113457] [ENSMUST00000125563] [ENSMUST00000152664]
AlphaFold Q9QZS0
Predicted Effect probably benign
Transcript: ENSMUST00000113457
AA Change: I1446L

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465
AA Change: I1446L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 41 102 9.6e-11 PFAM
Pfam:Collagen 97 164 3.6e-11 PFAM
Pfam:Collagen 164 223 3.6e-9 PFAM
low complexity region 233 243 N/A INTRINSIC
Pfam:Collagen 284 344 2.4e-10 PFAM
low complexity region 368 393 N/A INTRINSIC
Pfam:Collagen 415 477 5e-10 PFAM
Pfam:Collagen 481 545 1e-9 PFAM
low complexity region 550 585 N/A INTRINSIC
Pfam:Collagen 588 653 8.9e-9 PFAM
Pfam:Collagen 682 744 1.1e-8 PFAM
Pfam:Collagen 743 807 6.9e-10 PFAM
Pfam:Collagen 786 847 1.5e-8 PFAM
Pfam:Collagen 845 904 1.5e-10 PFAM
Pfam:Collagen 887 946 4.1e-10 PFAM
Pfam:Collagen 948 1006 8.1e-11 PFAM
Pfam:Collagen 997 1061 2.8e-10 PFAM
Pfam:Collagen 1057 1120 2.5e-10 PFAM
Pfam:Collagen 1114 1176 1.7e-9 PFAM
Pfam:Collagen 1174 1233 1.1e-9 PFAM
Pfam:Collagen 1232 1295 6.9e-9 PFAM
low complexity region 1326 1347 N/A INTRINSIC
Pfam:Collagen 1377 1439 4.9e-11 PFAM
C4 1444 1553 3.77e-70 SMART
C4 1554 1667 3.28e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125563
AA Change: I10L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137944
Gene: ENSMUSG00000079465
AA Change: I10L

DomainStartEndE-ValueType
Pfam:C4 8 60 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152664
AA Change: I10L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119094
Gene: ENSMUSG00000079465
AA Change: I10L

DomainStartEndE-ValueType
C4 8 117 3.77e-70 SMART
Pfam:C4 118 169 4.1e-14 PFAM
low complexity region 185 196 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T G 18: 57,592,067 L123V possibly damaging Het
1810022K09Rik C T 3: 14,607,245 V97I probably benign Het
2410089E03Rik T C 15: 8,203,793 W1201R probably damaging Het
4930404N11Rik T C 10: 81,364,015 D129G unknown Het
Adamts16 A T 13: 70,738,840 I975N probably benign Het
Adcy8 A G 15: 64,699,135 *1250Q probably null Het
Anapc1 A T 2: 128,664,032 I628N probably damaging Het
Ankrd39 C T 1: 36,539,358 probably benign Het
Ankub1 A T 3: 57,665,511 S263R possibly damaging Het
Aoah A G 13: 20,840,155 I94V probably benign Het
Aox2 A G 1: 58,289,954 D186G probably benign Het
Arap2 A T 5: 62,698,325 C589* probably null Het
Armt1 T C 10: 4,439,550 L69P probably damaging Het
Atxn7l3 T A 11: 102,292,772 Y185F probably benign Het
BC067074 A G 13: 113,319,759 T780A Het
Cacna2d4 A G 6: 119,241,181 D159G probably damaging Het
Camta2 C A 11: 70,670,358 R1184L probably benign Het
Ccr7 G A 11: 99,145,823 T91I probably damaging Het
Cdh9 A G 15: 16,831,045 T323A possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Clec2e C A 6: 129,093,411 G216* probably null Het
Col25a1 T C 3: 130,475,626 S176P unknown Het
Cse1l A G 2: 166,943,080 E823G probably damaging Het
Dchs2 A G 3: 83,354,456 E2677G possibly damaging Het
Dis3l T C 9: 64,339,542 E77G probably damaging Het
Dnah6 T C 6: 73,144,751 D1416G probably benign Het
Dpyd T C 3: 119,314,933 probably null Het
Dst A G 1: 34,228,855 D3112G probably damaging Het
Dusp13 A C 14: 21,734,906 N128K probably benign Het
Emilin2 T G 17: 71,275,084 K216Q probably benign Het
Enam T C 5: 88,494,088 W254R possibly damaging Het
Esrrg A C 1: 188,198,750 N346T possibly damaging Het
Fbn2 C T 18: 58,153,856 G244R probably damaging Het
Fbxw25 A G 9: 109,650,064 L373P Het
Gm21060 C A 19: 61,296,928 V48L possibly damaging Het
Gm30302 A T 13: 49,788,239 D80E probably benign Het
Gtpbp3 T C 8: 71,491,162 V254A possibly damaging Het
H2-DMb2 A G 17: 34,148,725 D171G probably damaging Het
Hrg A T 16: 22,959,218 T242S probably benign Het
Inf2 G T 12: 112,607,515 C751F unknown Het
Krt13 A T 11: 100,119,438 M239K possibly damaging Het
Lrrc72 A G 12: 36,253,294 S7P probably benign Het
Matn2 A G 15: 34,433,050 I867V probably benign Het
Mdh2 C T 5: 135,790,165 A325V possibly damaging Het
Mki67 C A 7: 135,695,635 A2557S possibly damaging Het
Mrpl16 A T 19: 11,772,943 R64* probably null Het
Nav1 T C 1: 135,584,725 D199G probably benign Het
Nbn T C 4: 15,986,585 V662A probably damaging Het
Nek10 G A 14: 14,931,321 probably null Het
Olfr141 C A 2: 86,806,856 V48F probably benign Het
Olfr298 A G 7: 86,489,279 S91P probably damaging Het
Olfr834 C A 9: 18,988,678 S230* probably null Het
Olfr884 T A 9: 38,047,543 V107D possibly damaging Het
Pcsk7 T G 9: 45,927,642 S617R probably benign Het
Pde10a C A 17: 8,924,239 Q6K probably benign Het
Pigq A C 17: 25,932,167 M396R probably damaging Het
Pkhd1l1 T A 15: 44,586,437 D3865E probably damaging Het
Prag1 C T 8: 36,099,590 probably benign Het
Rint1 A G 5: 23,811,730 T498A probably benign Het
Rnf213 T A 11: 119,461,930 F3921I Het
Rpp14 A G 14: 8,088,768 S95G probably benign Het
Ryk T G 9: 102,861,921 Y78D possibly damaging Het
Sez6 A T 11: 77,974,571 Q678L probably damaging Het
Slc22a21 T C 11: 53,969,576 K141E probably damaging Het
Slc30a5 A T 13: 100,806,694 I609K probably damaging Het
Slc44a4 T C 17: 34,921,562 F244L probably damaging Het
Susd5 T C 9: 114,082,504 Y161H possibly damaging Het
Syne3 A G 12: 104,959,395 probably null Het
Tbcd G C 11: 121,496,853 probably benign Het
Tmc1 A T 19: 20,900,851 N93K probably benign Het
Tmem100 T A 11: 90,035,476 M43K probably benign Het
Tmem131l A T 3: 83,928,732 V690D probably damaging Het
Trim8 A G 19: 46,515,464 Q485R possibly damaging Het
Vmn2r63 A T 7: 42,928,495 H206Q probably benign Het
Vmn2r77 T A 7: 86,802,942 N443K possibly damaging Het
Zan T A 5: 137,389,316 I4878F unknown Het
Zfand4 A G 6: 116,314,080 D344G probably benign Het
Other mutations in Col4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Col4a3 APN 1 82697754 missense unknown
IGL00847:Col4a3 APN 1 82717869 missense probably damaging 1.00
IGL01011:Col4a3 APN 1 82682301 missense unknown
IGL01102:Col4a3 APN 1 82669720 missense unknown
IGL01102:Col4a3 APN 1 82670255 missense unknown
IGL02071:Col4a3 APN 1 82660887 critical splice donor site probably null
IGL02244:Col4a3 APN 1 82669771 splice site probably benign
IGL02380:Col4a3 APN 1 82672788 splice site probably benign
IGL02431:Col4a3 APN 1 82679623 nonsense probably null
IGL02466:Col4a3 APN 1 82670192 missense unknown
IGL02694:Col4a3 APN 1 82710794 unclassified probably benign
IGL02709:Col4a3 APN 1 82679112 missense unknown
IGL02752:Col4a3 APN 1 82660225 missense unknown
IGL02792:Col4a3 APN 1 82718803 missense probably damaging 1.00
IGL03203:Col4a3 APN 1 82672639 nonsense probably null
IGL03218:Col4a3 APN 1 82643206 splice site probably benign
FR4976:Col4a3 UTSW 1 82718906 frame shift probably null
PIT4260001:Col4a3 UTSW 1 82682761 missense unknown
PIT4515001:Col4a3 UTSW 1 82682303 missense unknown
R0035:Col4a3 UTSW 1 82672753 missense unknown
R0099:Col4a3 UTSW 1 82717993 missense probably benign 0.41
R0433:Col4a3 UTSW 1 82670219 missense unknown
R0573:Col4a3 UTSW 1 82716363 missense possibly damaging 0.83
R0606:Col4a3 UTSW 1 82672586 splice site probably benign
R0715:Col4a3 UTSW 1 82652158 splice site probably benign
R0961:Col4a3 UTSW 1 82708576 splice site probably benign
R1257:Col4a3 UTSW 1 82716365 missense probably damaging 1.00
R1264:Col4a3 UTSW 1 82643301 splice site probably benign
R1373:Col4a3 UTSW 1 82690087 splice site probably benign
R1694:Col4a3 UTSW 1 82690663 splice site probably null
R1895:Col4a3 UTSW 1 82679108 missense unknown
R1925:Col4a3 UTSW 1 82700373 missense unknown
R1925:Col4a3 UTSW 1 82711874 unclassified probably benign
R2033:Col4a3 UTSW 1 82718011 intron probably benign
R2044:Col4a3 UTSW 1 82696319 missense unknown
R2122:Col4a3 UTSW 1 82654957 missense unknown
R2282:Col4a3 UTSW 1 82708638 missense unknown
R2318:Col4a3 UTSW 1 82648569 splice site probably null
R2421:Col4a3 UTSW 1 82670275 splice site probably benign
R2517:Col4a3 UTSW 1 82680710 missense unknown
R2965:Col4a3 UTSW 1 82648600 missense unknown
R3085:Col4a3 UTSW 1 82651258 missense unknown
R3150:Col4a3 UTSW 1 82657137 splice site probably null
R3947:Col4a3 UTSW 1 82715332 missense probably damaging 1.00
R4756:Col4a3 UTSW 1 82716297 critical splice acceptor site probably null
R4910:Col4a3 UTSW 1 82672679 missense unknown
R4928:Col4a3 UTSW 1 82710977 unclassified probably benign
R5044:Col4a3 UTSW 1 82666546 missense unknown
R5557:Col4a3 UTSW 1 82715247 unclassified probably benign
R5761:Col4a3 UTSW 1 82716057 nonsense probably null
R5970:Col4a3 UTSW 1 82716329 missense possibly damaging 0.76
R6576:Col4a3 UTSW 1 82708574 splice site probably null
R6583:Col4a3 UTSW 1 82641476 missense unknown
R6675:Col4a3 UTSW 1 82668925 missense unknown
R7170:Col4a3 UTSW 1 82715909 splice site probably null
R7592:Col4a3 UTSW 1 82648617 missense unknown
R7624:Col4a3 UTSW 1 82718884 missense probably benign
R7994:Col4a3 UTSW 1 82662906 missense unknown
R8127:Col4a3 UTSW 1 82649760 missense unknown
R8702:Col4a3 UTSW 1 82710979 missense unknown
R8865:Col4a3 UTSW 1 82669762 critical splice donor site probably null
R9611:Col4a3 UTSW 1 82700297 missense unknown
R9665:Col4a3 UTSW 1 82690580 missense unknown
R9765:Col4a3 UTSW 1 82668957 nonsense probably null
X0067:Col4a3 UTSW 1 82716159 missense probably damaging 0.99
Z1177:Col4a3 UTSW 1 82690039 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCCCACTCGTCTCTAAGATTC -3'
(R):5'- CCTATAAATAGTGTACACTCAGCATCG -3'

Sequencing Primer
(F):5'- TTTCATATTTGAGGCTTACCAGC -3'
(R):5'- GTGTACACTCAGCATCGTAAACTG -3'
Posted On 2021-10-11