Mutagenetix > Incidental Mutation

Incidental Mutation 'R9658:Eif2ak4'

735522

Institutional Source

Beutler Lab

Gene Symbol

Eif2ak4

Ensembl Gene

ENSMUSG00000005102

Gene Name

eukaryotic translation initiation factor 2 alpha kinase 4

Synonyms

GCN2

MMRRC Submission

Accession Numbers

MGI: 1353427

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9658 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118388618-118475234 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118439030 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 862 (I862T)

Ref Sequence

ENSEMBL: ENSMUSP00000005233 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005233] [ENSMUST00000102527] [ENSMUST00000110869] [ENSMUST00000110870] [ENSMUST00000110872] [ENSMUST00000110874]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000005233
AA Change: I862T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000005233
Gene: ENSMUSG00000005102
AA Change: I862T

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
RWD	25	137	3.42e-38	SMART
coiled coil region	146	205	N/A	INTRINSIC
Pfam:Pkinase	323	538	4.6e-27	PFAM
Pfam:Pkinase_Tyr	326	535	5.5e-18	PFAM
Pfam:Pkinase	589	663	1.7e-11	PFAM
Pfam:Pkinase_Tyr	589	663	1.2e-5	PFAM
low complexity region	728	738	N/A	INTRINSIC
Pfam:Pkinase	781	1000	2.6e-38	PFAM
Pfam:Pkinase_Tyr	786	998	1.8e-18	PFAM
Pfam:tRNA-synt_His	1054	1380	5.7e-18	PFAM
Pfam:HGTP_anticodon2	1392	1647	5.8e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102527
AA Change: I750T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099586
Gene: ENSMUSG00000005102
AA Change: I750T

Domain	Start	End	E-Value	Type
coiled coil region	34	93	N/A	INTRINSIC
Pfam:Pkinase	211	426	1.6e-22	PFAM
Pfam:Pkinase_Tyr	215	423	6.8e-18	PFAM
Pfam:Pkinase_Tyr	477	551	1.2e-5	PFAM
Pfam:Pkinase	477	552	3.9e-11	PFAM
low complexity region	616	626	N/A	INTRINSIC
Pfam:Pkinase	647	888	9.4e-42	PFAM
Pfam:Pkinase_Tyr	672	886	1.4e-19	PFAM
Pfam:tRNA-synt_His	941	1268	4.8e-19	PFAM
Pfam:HGTP_anticodon2	1280	1535	1e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110869
AA Change: I61T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106493
Gene: ENSMUSG00000005102
AA Change: I61T

Domain	Start	End	E-Value	Type
Pfam:Pkinase	15	199	2.3e-32	PFAM
Pfam:Pkinase_Tyr	16	198	3.1e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110870
AA Change: I584T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106494
Gene: ENSMUSG00000005102
AA Change: I584T

Domain	Start	End	E-Value	Type
Pfam:Pkinase	45	260	3.3e-22	PFAM
Pfam:Pkinase_Tyr	47	257	1.3e-17	PFAM
Pfam:Pkinase_Tyr	311	385	2.5e-5	PFAM
Pfam:Pkinase	311	386	8e-11	PFAM
low complexity region	450	460	N/A	INTRINSIC
Pfam:Pkinase	481	722	1.9e-41	PFAM
Pfam:Pkinase_Tyr	506	720	2.8e-19	PFAM
Pfam:tRNA-synt_His	775	1102	8.7e-19	PFAM
Pfam:HGTP_anticodon2	1114	1369	1.9e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110872
AA Change: I741T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106496
Gene: ENSMUSG00000005102
AA Change: I741T

Domain	Start	End	E-Value	Type
coiled coil region	25	84	N/A	INTRINSIC
Pfam:Pkinase	202	417	3.8e-22	PFAM
Pfam:Pkinase_Tyr	206	414	1.6e-17	PFAM
Pfam:Pkinase_Tyr	468	542	2.8e-5	PFAM
Pfam:Pkinase	468	543	9.1e-11	PFAM
low complexity region	607	617	N/A	INTRINSIC
Pfam:Pkinase	638	879	2.2e-41	PFAM
Pfam:Pkinase_Tyr	663	877	3.3e-19	PFAM
Pfam:tRNA-synt_His	932	1259	1.1e-18	PFAM
Pfam:HGTP_anticodon2	1271	1526	2.2e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110874
AA Change: I784T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106498
Gene: ENSMUSG00000005102
AA Change: I784T

Domain	Start	End	E-Value	Type
Pfam:RWD	8	56	6.4e-8	PFAM
coiled coil region	68	127	N/A	INTRINSIC
Pfam:Pkinase	245	460	1.1e-22	PFAM
Pfam:Pkinase_Tyr	247	457	4.2e-18	PFAM
Pfam:Pkinase_Tyr	511	585	7.8e-6	PFAM
Pfam:Pkinase	511	586	2.5e-11	PFAM
low complexity region	650	660	N/A	INTRINSIC
Pfam:Pkinase	681	922	6.2e-42	PFAM
Pfam:Pkinase_Tyr	706	920	9.3e-20	PFAM
Pfam:tRNA-synt_His	975	1302	3.8e-19	PFAM
Pfam:HGTP_anticodon2	1314	1569	5.4e-17	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.4%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2), resulting in the downregulaton of protein synthesis. The encoded protein responds to amino acid deprivation by binding uncharged transfer RNAs. It may also be activated by glucose deprivation and viral infection. Mutations in this gene have been found in individuals suffering from autosomal recessive pulmonary venoocclusive-disease-2. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a null allele have altered feeding behavior, synaptic plasticity and dendritic cell function. Homozygotes for another null allele show enhanced muscle loss and morbidity after amino acid deprivation. Homozygotes for an ENU-induced allele show higher susceptibility to viral infection. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(4) Chemically induced(1)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	C	T	18: 70,467,330		probably null	Het
Abca12	T	C	1: 71,286,475	I1521M	probably damaging	Het
Abcc3	A	G	11: 94,372,877	S268P	possibly damaging	Het
Adamts20	G	C	15: 94,351,745	P464A	probably damaging	Het
Apoa1	C	A	9: 46,229,982	D125E	probably benign	Het
Atp6v0a1	C	A	11: 101,018,588	Q48K	probably benign	Het
Bptf	T	C	11: 107,111,344	N314S	probably damaging	Het
Cdh7	T	C	1: 110,061,055	V229A	probably damaging	Het
Cfap46	G	A	7: 139,666,313	T378M		Het
Clca3b	T	A	3: 144,837,814	D418V	probably damaging	Het
Dennd4c	T	A	4: 86,836,388	L1545*	probably null	Het
Dnajc13	A	G	9: 104,238,529	V27A	probably benign	Het
Eif2ak2	A	T	17: 78,876,203	D72E	probably benign	Het
Eif4g1	T	C	16: 20,684,113	I1022T	probably benign	Het
Enpp3	A	T	10: 24,773,904	*875R	probably null	Het
F11	T	C	8: 45,245,634	Y491C	probably damaging	Het
Fam155a	T	C	8: 9,770,114	D302G	probably benign	Het
Fam98c	A	C	7: 29,152,781	W118G	probably damaging	Het
Fbxo43	A	T	15: 36,152,136	L509Q	probably damaging	Het
Fbxw5	A	G	2: 25,503,858	H366R	probably damaging	Het
Flt1	G	T	5: 147,588,567	N920K	probably damaging	Het
Git1	T	A	11: 77,499,755	F106I	probably damaging	Het
Glipr1l2	A	G	10: 112,106,963	E241G	probably damaging	Het
Gm11639	A	G	11: 104,720,294	K321E	probably benign	Het
Gm2381	A	C	7: 42,820,305	C132G	probably damaging	Het
Gm49383	A	G	12: 69,192,854	I237T		Het
Gm7324	T	A	14: 43,714,825	D308E	probably benign	Het
Gpr17	A	G	18: 31,947,368	L214P	probably damaging	Het
Gtf3c1	A	T	7: 125,707,562	L39Q	probably damaging	Het
H2-Q6	C	T	17: 35,425,209	R56C	probably damaging	Het
Hcar2	T	C	5: 123,864,469	T324A	possibly damaging	Het
Ksr2	T	C	5: 117,747,360	S750P	probably damaging	Het
Lipi	C	A	16: 75,560,801	R292L	probably benign	Het
Map4k3	C	A	17: 80,653,877	M133I	probably benign	Het
Marf1	A	T	16: 14,140,223	L805Q	probably damaging	Het
Mccc2	T	A	13: 99,954,246	R460W	probably damaging	Het
Mgam	A	G	6: 40,744,377	D312G	possibly damaging	Het
Nadk2	A	T	15: 9,103,361	K360*	probably null	Het
Nars2	A	G	7: 97,039,971	I367V	probably benign	Het
Nppb	T	C	4: 147,986,494	S109P	possibly damaging	Het
Odf2	G	A	2: 29,889,801	R15Q	probably benign	Het
Olfr1312	C	A	2: 112,042,478	A185S	probably damaging	Het
Olfr209	A	T	16: 59,361,743	H158Q	probably damaging	Het
Olfr630	C	T	7: 103,754,821	V255M	probably damaging	Het
Osbpl1a	A	T	18: 12,756,212	I949N	probably benign	Het
Pan3	T	C	5: 147,543,071	F55L	probably benign	Het
Patj	A	G	4: 98,465,140	D640G	probably null	Het
Pdxk	T	C	10: 78,451,569	K53E	probably benign	Het
Pja2	A	G	17: 64,292,873	S539P	probably damaging	Het
Plscr1	T	A	9: 92,266,482	C158*	probably null	Het
Prdm14	T	C	1: 13,118,921	T400A	probably benign	Het
Rag1	C	T	2: 101,642,884	V638M	possibly damaging	Het
Ros1	A	G	10: 52,090,973	S1734P	probably damaging	Het
S100a9	T	C	3: 90,692,774	H105R	unknown	Het
Shisa9	A	T	16: 12,244,656	Q247L	possibly damaging	Het
Slc14a1	C	A	18: 78,109,592	A367S	probably damaging	Het
Slc27a4	G	A	2: 29,811,289	R364Q	probably damaging	Het
Spag17	C	T	3: 100,027,616	P713S	possibly damaging	Het
Tbc1d4	T	A	14: 101,608,420	H14L	probably damaging	Het
Tmem144	T	A	3: 79,822,684	Y253F	probably damaging	Het
Tmem204	C	T	17: 25,080,348	G66R	possibly damaging	Het
Tnfrsf1b	A	T	4: 145,215,854	V453E	probably damaging	Het
Tns1	G	C	1: 73,942,023	Q1061E	probably benign	Het
Tns1	G	T	1: 73,942,024	N1060K	probably benign	Het
Trav5-1	A	G	14: 52,622,971	K78E	probably benign	Het
Ttn	C	T	2: 76,885,013	E7912K	unknown	Het
Usp17lc	G	A	7: 103,418,182	G228D	possibly damaging	Het
Uvssa	T	C	5: 33,410,989	C574R	probably damaging	Het
Veph1	G	A	3: 66,264,013	Q3*	probably null	Het
Vps13b	T	A	15: 35,623,628	D1230E	probably benign	Het
Xkr9	T	A	1: 13,701,094	I278N	probably damaging	Het
Zbed4	C	A	15: 88,780,539	A270E	probably benign	Het
Zfp366	A	T	13: 99,228,927	T199S	probably benign	Het

Other mutations in Eif2ak4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Eif2ak4	APN	2	118464055	missense	probably damaging	1.00
IGL00806:Eif2ak4	APN	2	118441166	missense	probably benign	0.08
IGL01343:Eif2ak4	APN	2	118422089	missense	probably benign	0.00
IGL01796:Eif2ak4	APN	2	118446304	missense	probably benign	0.10
IGL02263:Eif2ak4	APN	2	118461778	missense	probably benign	0.00
IGL02391:Eif2ak4	APN	2	118420791	missense	probably benign	0.19
IGL02516:Eif2ak4	APN	2	118436254	missense	probably damaging	1.00
IGL02603:Eif2ak4	APN	2	118450326	missense	probably damaging	1.00
IGL02731:Eif2ak4	APN	2	118388814	missense	probably benign
IGL02928:Eif2ak4	APN	2	118472687	critical splice donor site	probably null
IGL02947:Eif2ak4	APN	2	118431033	missense	probably benign	0.00
IGL03191:Eif2ak4	APN	2	118422212	missense	probably damaging	1.00
IGL03202:Eif2ak4	APN	2	118400620	missense	probably damaging	1.00
IGL03235:Eif2ak4	APN	2	118443140	missense	probably damaging	1.00
IGL03375:Eif2ak4	APN	2	118422318	missense	probably benign	0.08
absurdum	UTSW	2	118420810	nonsense	probably null
Ad	UTSW	2	118436241	missense	probably damaging	1.00
atchoum	UTSW	2	118400653	splice site	probably benign
reductio	UTSW	2	118436158	splice site	probably null
PIT4520001:Eif2ak4	UTSW	2	118462327	missense	probably damaging	1.00
R0023:Eif2ak4	UTSW	2	118462721	missense	probably damaging	1.00
R0358:Eif2ak4	UTSW	2	118463929	splice site	probably null
R0482:Eif2ak4	UTSW	2	118462347	missense	probably damaging	1.00
R0505:Eif2ak4	UTSW	2	118431036	missense	probably benign	0.01
R0523:Eif2ak4	UTSW	2	118442096	critical splice donor site	probably null
R0578:Eif2ak4	UTSW	2	118474991	splice site	probably benign
R0615:Eif2ak4	UTSW	2	118436185	missense	probably damaging	1.00
R1300:Eif2ak4	UTSW	2	118463983	missense	possibly damaging	0.79
R1531:Eif2ak4	UTSW	2	118443210	missense	probably damaging	1.00
R1777:Eif2ak4	UTSW	2	118430839	missense	probably damaging	0.98
R1866:Eif2ak4	UTSW	2	118472661	missense	probably damaging	1.00
R1932:Eif2ak4	UTSW	2	118448486	missense	probably damaging	1.00
R1977:Eif2ak4	UTSW	2	118461757	nonsense	probably null
R2011:Eif2ak4	UTSW	2	118430947	missense	probably damaging	1.00
R2046:Eif2ak4	UTSW	2	118451408	splice site	probably benign
R2122:Eif2ak4	UTSW	2	118455793	missense	probably damaging	1.00
R2125:Eif2ak4	UTSW	2	118422123	missense	probably benign	0.02
R2126:Eif2ak4	UTSW	2	118422123	missense	probably benign	0.02
R2193:Eif2ak4	UTSW	2	118422266	missense	probably benign	0.12
R2259:Eif2ak4	UTSW	2	118455783	missense	probably damaging	0.97
R2513:Eif2ak4	UTSW	2	118426583	missense	probably damaging	1.00
R3798:Eif2ak4	UTSW	2	118474083	missense	probably damaging	1.00
R3898:Eif2ak4	UTSW	2	118430923	missense	probably damaging	1.00
R3900:Eif2ak4	UTSW	2	118475029	missense	probably damaging	1.00
R4375:Eif2ak4	UTSW	2	118427924	missense	probably damaging	1.00
R4423:Eif2ak4	UTSW	2	118439066	missense	probably benign	0.01
R4589:Eif2ak4	UTSW	2	118417338	missense	probably damaging	1.00
R4734:Eif2ak4	UTSW	2	118422087	missense	probably damaging	1.00
R5173:Eif2ak4	UTSW	2	118408360	missense	probably damaging	1.00
R5367:Eif2ak4	UTSW	2	118436158	splice site	probably null
R5471:Eif2ak4	UTSW	2	118474132	missense	probably benign	0.02
R5528:Eif2ak4	UTSW	2	118427938	missense	probably damaging	1.00
R5634:Eif2ak4	UTSW	2	118462311	missense	probably damaging	1.00
R5726:Eif2ak4	UTSW	2	118443132	missense	probably damaging	1.00
R5756:Eif2ak4	UTSW	2	118462740	missense	possibly damaging	0.95
R5779:Eif2ak4	UTSW	2	118412963	missense	possibly damaging	0.85
R5807:Eif2ak4	UTSW	2	118388851	missense	probably benign
R6045:Eif2ak4	UTSW	2	118388815	nonsense	probably null
R6187:Eif2ak4	UTSW	2	118457157	missense	probably damaging	0.98
R6193:Eif2ak4	UTSW	2	118400600	start gained	probably benign
R6468:Eif2ak4	UTSW	2	118436241	missense	probably damaging	1.00
R6555:Eif2ak4	UTSW	2	118427869	missense	probably damaging	0.96
R6616:Eif2ak4	UTSW	2	118454845	nonsense	probably null
R6737:Eif2ak4	UTSW	2	118462268	frame shift	probably null
R6956:Eif2ak4	UTSW	2	118422267	missense	probably damaging	0.96
R7075:Eif2ak4	UTSW	2	118420810	nonsense	probably null
R7109:Eif2ak4	UTSW	2	118405051	missense	probably damaging	1.00
R7228:Eif2ak4	UTSW	2	118457157	missense	probably damaging	0.98
R7441:Eif2ak4	UTSW	2	118471896	missense	probably benign	0.01
R7555:Eif2ak4	UTSW	2	118417283	missense	possibly damaging	0.64
R7567:Eif2ak4	UTSW	2	118450314	missense	probably benign
R8004:Eif2ak4	UTSW	2	118417294	missense	possibly damaging	0.64
R8063:Eif2ak4	UTSW	2	118410901	missense	possibly damaging	0.94
R8092:Eif2ak4	UTSW	2	118442032	missense	probably damaging	1.00
R8195:Eif2ak4	UTSW	2	118450338	missense	possibly damaging	0.50
R8306:Eif2ak4	UTSW	2	118457175	missense	possibly damaging	0.68
R8470:Eif2ak4	UTSW	2	118462726	missense	probably damaging	0.98
R8671:Eif2ak4	UTSW	2	118422186	missense	possibly damaging	0.88
R8693:Eif2ak4	UTSW	2	118432237	missense	probably damaging	0.98
R8714:Eif2ak4	UTSW	2	118462284	missense	possibly damaging	0.89
R8744:Eif2ak4	UTSW	2	118430993	nonsense	probably null
R8813:Eif2ak4	UTSW	2	118448325	missense	probably damaging	1.00
R8917:Eif2ak4	UTSW	2	118457136	missense	probably damaging	1.00
R8924:Eif2ak4	UTSW	2	118428032	missense	probably damaging	1.00
R9177:Eif2ak4	UTSW	2	118441220	critical splice donor site	probably null
R9189:Eif2ak4	UTSW	2	118427912	missense	probably damaging	1.00
R9231:Eif2ak4	UTSW	2	118441181	missense	probably benign	0.00
R9268:Eif2ak4	UTSW	2	118441220	critical splice donor site	probably null
R9321:Eif2ak4	UTSW	2	118462317	missense	possibly damaging	0.93
R9512:Eif2ak4	UTSW	2	118462715	missense	probably damaging	1.00
R9569:Eif2ak4	UTSW	2	118420835	missense	probably benign	0.00
R9748:Eif2ak4	UTSW	2	118417249	missense	probably benign	0.01
R9757:Eif2ak4	UTSW	2	118438917	missense	probably benign	0.02
R9766:Eif2ak4	UTSW	2	118430832	nonsense	probably null
X0061:Eif2ak4	UTSW	2	118468176	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGAGAAGACTCATCCAGTG -3'
(R):5'- AGACACACTTGCAGACTGTCC -3'

Sequencing Primer
(F):5'- GAGAAGACTCATCCAGTGGTCATC -3'
(R):5'- TTCAGGCTTGCCTCACAGTAGAG -3'

Posted On

2022-11-14