Mutagenetix > Incidental Mutation

Incidental Mutation 'R9658:Enpp3'

735550

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.195) question?

Stock #

R9658 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

A to T at 24773904 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Arginine at position 875 (*875R)

Ref Sequence

ENSEMBL: ENSMUSP00000020169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169]

AlphaFold

Q6DYE8

Predicted Effect

probably null
Transcript: ENSMUST00000020169
AA Change: *875R

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: *875R

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218343

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.4%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	C	T	18: 70,467,330		probably null	Het
Abca12	T	C	1: 71,286,475	I1521M	probably damaging	Het
Abcc3	A	G	11: 94,372,877	S268P	possibly damaging	Het
Adamts20	G	C	15: 94,351,745	P464A	probably damaging	Het
Apoa1	C	A	9: 46,229,982	D125E	probably benign	Het
Atp6v0a1	C	A	11: 101,018,588	Q48K	probably benign	Het
Bptf	T	C	11: 107,111,344	N314S	probably damaging	Het
Cdh7	T	C	1: 110,061,055	V229A	probably damaging	Het
Cfap46	G	A	7: 139,666,313	T378M		Het
Clca3b	T	A	3: 144,837,814	D418V	probably damaging	Het
Dennd4c	T	A	4: 86,836,388	L1545*	probably null	Het
Dnajc13	A	G	9: 104,238,529	V27A	probably benign	Het
Eif2ak2	A	T	17: 78,876,203	D72E	probably benign	Het
Eif2ak4	T	C	2: 118,439,030	I862T	probably damaging	Het
Eif4g1	T	C	16: 20,684,113	I1022T	probably benign	Het
F11	T	C	8: 45,245,634	Y491C	probably damaging	Het
Fam155a	T	C	8: 9,770,114	D302G	probably benign	Het
Fam98c	A	C	7: 29,152,781	W118G	probably damaging	Het
Fbxo43	A	T	15: 36,152,136	L509Q	probably damaging	Het
Fbxw5	A	G	2: 25,503,858	H366R	probably damaging	Het
Flt1	G	T	5: 147,588,567	N920K	probably damaging	Het
Git1	T	A	11: 77,499,755	F106I	probably damaging	Het
Glipr1l2	A	G	10: 112,106,963	E241G	probably damaging	Het
Gm11639	A	G	11: 104,720,294	K321E	probably benign	Het
Gm2381	A	C	7: 42,820,305	C132G	probably damaging	Het
Gm49383	A	G	12: 69,192,854	I237T		Het
Gm7324	T	A	14: 43,714,825	D308E	probably benign	Het
Gpr17	A	G	18: 31,947,368	L214P	probably damaging	Het
Gtf3c1	A	T	7: 125,707,562	L39Q	probably damaging	Het
H2-Q6	C	T	17: 35,425,209	R56C	probably damaging	Het
Hcar2	T	C	5: 123,864,469	T324A	possibly damaging	Het
Ksr2	T	C	5: 117,747,360	S750P	probably damaging	Het
Lipi	C	A	16: 75,560,801	R292L	probably benign	Het
Map4k3	C	A	17: 80,653,877	M133I	probably benign	Het
Marf1	A	T	16: 14,140,223	L805Q	probably damaging	Het
Mccc2	T	A	13: 99,954,246	R460W	probably damaging	Het
Mgam	A	G	6: 40,744,377	D312G	possibly damaging	Het
Nadk2	A	T	15: 9,103,361	K360*	probably null	Het
Nars2	A	G	7: 97,039,971	I367V	probably benign	Het
Nppb	T	C	4: 147,986,494	S109P	possibly damaging	Het
Odf2	G	A	2: 29,889,801	R15Q	probably benign	Het
Olfr1312	C	A	2: 112,042,478	A185S	probably damaging	Het
Olfr209	A	T	16: 59,361,743	H158Q	probably damaging	Het
Olfr630	C	T	7: 103,754,821	V255M	probably damaging	Het
Osbpl1a	A	T	18: 12,756,212	I949N	probably benign	Het
Pan3	T	C	5: 147,543,071	F55L	probably benign	Het
Patj	A	G	4: 98,465,140	D640G	probably null	Het
Pdxk	T	C	10: 78,451,569	K53E	probably benign	Het
Pja2	A	G	17: 64,292,873	S539P	probably damaging	Het
Plscr1	T	A	9: 92,266,482	C158*	probably null	Het
Prdm14	T	C	1: 13,118,921	T400A	probably benign	Het
Rag1	C	T	2: 101,642,884	V638M	possibly damaging	Het
Ros1	A	G	10: 52,090,973	S1734P	probably damaging	Het
S100a9	T	C	3: 90,692,774	H105R	unknown	Het
Shisa9	A	T	16: 12,244,656	Q247L	possibly damaging	Het
Slc14a1	C	A	18: 78,109,592	A367S	probably damaging	Het
Slc27a4	G	A	2: 29,811,289	R364Q	probably damaging	Het
Spag17	C	T	3: 100,027,616	P713S	possibly damaging	Het
Tbc1d4	T	A	14: 101,608,420	H14L	probably damaging	Het
Tmem144	T	A	3: 79,822,684	Y253F	probably damaging	Het
Tmem204	C	T	17: 25,080,348	G66R	possibly damaging	Het
Tnfrsf1b	A	T	4: 145,215,854	V453E	probably damaging	Het
Tns1	G	C	1: 73,942,023	Q1061E	probably benign	Het
Tns1	G	T	1: 73,942,024	N1060K	probably benign	Het
Trav5-1	A	G	14: 52,622,971	K78E	probably benign	Het
Ttn	C	T	2: 76,885,013	E7912K	unknown	Het
Usp17lc	G	A	7: 103,418,182	G228D	possibly damaging	Het
Uvssa	T	C	5: 33,410,989	C574R	probably damaging	Het
Veph1	G	A	3: 66,264,013	Q3*	probably null	Het
Vps13b	T	A	15: 35,623,628	D1230E	probably benign	Het
Xkr9	T	A	1: 13,701,094	I278N	probably damaging	Het
Zbed4	C	A	15: 88,780,539	A270E	probably benign	Het
Zfp366	A	T	13: 99,228,927	T199S	probably benign	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8262:Enpp3	UTSW	10	24777926	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
R8776:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8776-TAIL:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8962:Enpp3	UTSW	10	24820615	missense	probably benign	0.12
R9047:Enpp3	UTSW	10	24798274	missense	possibly damaging	0.83
R9093:Enpp3	UTSW	10	24795804	missense	probably benign	0.00
R9117:Enpp3	UTSW	10	24826180	missense	possibly damaging	0.67
R9194:Enpp3	UTSW	10	24799194	missense	possibly damaging	0.90
R9224:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R9244:Enpp3	UTSW	10	24778791	missense	probably damaging	1.00
R9387:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R9644:Enpp3	UTSW	10	24809903	missense	probably damaging	0.98
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAACACCATGCGTTTCTGC -3'
(R):5'- TTCTCAGGAAAACAAGACCGAG -3'

Sequencing Primer
(F):5'- AATGTCACCAGCTCTATAGGACTCTG -3'
(R):5'- CAAGACCGAGGACCTTTGG -3'

Posted On

2022-11-14