Incidental Mutation 'R0939:Olfr516'
ID81309
Institutional Source Beutler Lab
Gene Symbol Olfr516
Ensembl Gene ENSMUSG00000062434
Gene Nameolfactory receptor 516
SynonymsGA_x6K02T2PBJ9-11176324-11175380, MOR268-2
MMRRC Submission 039078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R0939 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108844788-108850529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108845233 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 259 (Y259F)
Ref Sequence ENSEMBL: ENSMUSP00000150359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071410] [ENSMUST00000216092] [ENSMUST00000217279]
Predicted Effect probably damaging
Transcript: ENSMUST00000071410
AA Change: Y259F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071358
Gene: ENSMUSG00000062434
AA Change: Y259F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.9e-5 PFAM
Pfam:7tm_1 41 290 9.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208389
Predicted Effect probably damaging
Transcript: ENSMUST00000216092
AA Change: Y259F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217279
AA Change: Y259F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,143 V419M probably damaging Het
Cdcp1 A G 9: 123,183,690 V264A probably damaging Het
Cfap53 A G 18: 74,305,730 D326G probably null Het
Dach1 A G 14: 97,915,924 V436A probably damaging Het
Dnah11 C T 12: 118,060,407 G1870S probably damaging Het
Dst C A 1: 34,244,383 H5324N probably damaging Het
Eapp TTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTT 12: 54,685,949 probably benign Het
Esd C A 14: 74,736,027 H21N probably damaging Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Igdcc4 T A 9: 65,131,473 probably null Het
Mug1 A T 6: 121,884,349 I1310F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Olfr1013 T A 2: 85,770,653 L284* probably null Het
Olfr1564 T C 17: 33,215,661 K231E possibly damaging Het
Pcdh17 A G 14: 84,447,755 D554G probably damaging Het
Plcxd3 T A 15: 4,516,862 L116* probably null Het
Prss1 A C 6: 41,463,588 D199A probably damaging Het
Rbms3 C T 9: 117,109,960 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rreb1 A G 13: 37,932,231 M1189V probably benign Het
Slc25a39 T C 11: 102,405,051 E118G probably damaging Het
Slfn5 G T 11: 82,961,338 M763I probably benign Het
Speer4f2 A G 5: 17,374,404 E67G probably damaging Het
Spef2 A T 15: 9,704,550 probably null Het
Spocd1 A T 4: 129,948,870 D26V possibly damaging Het
Ssh1 A G 5: 113,970,436 L50P probably damaging Het
Tle1 A G 4: 72,118,534 L728P probably damaging Het
Trio A G 15: 27,741,250 probably null Het
Tubb1 G A 2: 174,455,756 E53K probably damaging Het
Vmn2r71 A T 7: 85,623,681 T568S possibly damaging Het
Other mutations in Olfr516
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Olfr516 APN 7 108845680 missense probably damaging 0.99
R0583:Olfr516 UTSW 7 108845414 missense possibly damaging 0.87
R1037:Olfr516 UTSW 7 108845984 missense probably benign 0.04
R1631:Olfr516 UTSW 7 108845857 missense probably damaging 1.00
R1691:Olfr516 UTSW 7 108845141 missense possibly damaging 0.60
R5153:Olfr516 UTSW 7 108845699 missense probably benign 0.03
R6114:Olfr516 UTSW 7 108845386 missense possibly damaging 0.53
R6305:Olfr516 UTSW 7 108845554 missense possibly damaging 0.87
R6808:Olfr516 UTSW 7 108845540 missense probably benign 0.01
R6896:Olfr516 UTSW 7 108845543 missense probably benign
R7544:Olfr516 UTSW 7 108845321 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AGTTCCTCAACAAATCAACCTGTGTGT -3'
(R):5'- GGGTGTTTAGCTTCCCCTACTGTGA -3'

Sequencing Primer
(F):5'- CAACCTGTGTGTAAAGTCACTTTTC -3'
(R):5'- TGAAGTCTATGCCTTCACAGG -3'
Posted On2013-11-07