Incidental Mutation 'R6114:Olfr516'
ID485020
Institutional Source Beutler Lab
Gene Symbol Olfr516
Ensembl Gene ENSMUSG00000062434
Gene Nameolfactory receptor 516
SynonymsGA_x6K02T2PBJ9-11176324-11175380, MOR268-2
MMRRC Submission 044263-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6114 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108844788-108850529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108845386 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 208 (M208K)
Ref Sequence ENSEMBL: ENSMUSP00000150359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071410] [ENSMUST00000216092] [ENSMUST00000217279]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071410
AA Change: M208K

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071358
Gene: ENSMUSG00000062434
AA Change: M208K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.9e-5 PFAM
Pfam:7tm_1 41 290 9.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208389
Predicted Effect possibly damaging
Transcript: ENSMUST00000216092
AA Change: M208K

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217279
AA Change: M208K

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.6545 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 V237L probably benign Het
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Blm T C 7: 80,513,487 T39A probably damaging Het
Cabin1 T A 10: 75,747,971 M221L probably benign Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Cpxm2 A G 7: 132,154,306 V103A probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hoxd9 A G 2: 74,699,365 N322D probably damaging Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nr1h4 T A 10: 89,478,816 N273Y possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pde2a A T 7: 101,511,112 probably null Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Rora A G 9: 69,371,323 N254S probably benign Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc38a10 G A 11: 120,129,312 Q305* probably null Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 I988F probably damaging Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Olfr516
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Olfr516 APN 7 108845680 missense probably damaging 0.99
R0583:Olfr516 UTSW 7 108845414 missense possibly damaging 0.87
R0939:Olfr516 UTSW 7 108845233 missense probably damaging 1.00
R1037:Olfr516 UTSW 7 108845984 missense probably benign 0.04
R1631:Olfr516 UTSW 7 108845857 missense probably damaging 1.00
R1691:Olfr516 UTSW 7 108845141 missense possibly damaging 0.60
R5153:Olfr516 UTSW 7 108845699 missense probably benign 0.03
R6305:Olfr516 UTSW 7 108845554 missense possibly damaging 0.87
R6808:Olfr516 UTSW 7 108845540 missense probably benign 0.01
R6896:Olfr516 UTSW 7 108845543 missense probably benign
R7544:Olfr516 UTSW 7 108845321 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AGAAGTGTGTATGCCAGTGAC -3'
(R):5'- CATGGGTCTCAGGTACCATG -3'

Sequencing Primer
(F):5'- GTATGCCAGTGACATCAGTTTC -3'
(R):5'- GGTCTCAGGTACCATGATGACTAC -3'
Posted On2017-08-16